Placenta
Volume 31, Issue 3 , Pages 240-244, March 2010

Estrogen-regulated Expression and Distribution of Id-1 in the Mouse Uterus

Division of Reproductive Endocrinology and Infertility, Department of Obstetrics and Gynecology, College of Medicine, University of Ulsan, Asan Medical Center, 388-1, Poognap-dong, Songpa-gu, Seoul 138-736, Republic of Korea

Accepted 27 November 2009. published online 23 December 2009.

Article Outline

Abstract 

Id genes are involved in proliferation and differentiation in various cell types. However, it remains to be fully investigated how Id genes are regulated in highly dynamic uterine tissue. Using cDNA microarray, we previously observed that Id-1 was upregulated in uteri from ovariectomized (OVX) mice exposed to 17β-estradiol (E2). Here, we further examined the expression pattern of Id-1 and its regulation of by E2 and progesterone (P4) in the mouse uterus. Increased Id-1 transcripts in OVX mice uterus exposed to E2 were efficiently reduced by pretreatment with ICI 182,780 (an antagonist for nuclear estrogen receptor), suggesting that E2 induced expression of Id-1 is mediated via classical estrogen receptor (ER). In contrast, P4 treatment did not enhance or antagonize the action of E2 on Id-1 expression. Laser capture microdissection revealed that Id-1 is exclusively expressed in luminal epithelial cells. Notably, Id-1 was significantly upregulated at implantation sites on day 4.5 of pregnancy due to strong expression of Id-1 in blastocyst stage embryos. The present results show that the expression of Id-1 in the mouse uterus is tightly regulated by E2 via classical ER genomic pathway, not P4 suggesting an important role in uterine physiological events such as the estrous cycle and implantation process.

Keywords: id-1, Estrogen, Uterus

 

Back to Article Outline

1. Introduction 

Helix–loop–helix (HLH) transcription factors are important modulators in the transcriptional network regulating cell proliferation and differentiation during developmental processes in both vertebrates and invertebrates [1], [2]. They are generally grouped into seven classes (I−VII) based on tissue localization, dimerization, and DNA binding specificities [2], [3]. Most of these genes containing the basic HLH family act as transcriptional regulators of various genes through direct DNA binding to the E-box sequence (CANNTG) [4]. However, several members of the HLH class V subfamily, known as Id genes (inhibitor of DNA binding), act as dominant negative regulators of transcription factors because the Id genes have no basic region [5]. Four members of the Id family have been identified in mammals (Id-1, -2, -3, and -4) and their proteins have a highly homologous HLH domain [5], [6], [7], [8]. As with many other important genes, there are recent evidences that Id gene is key regulator of cell growth, differentiation, proliferation, and tumorigenesis in various cell types [9], [10]. The unique and overlapping patterns of expression of Id genes contribute to the specific differentiation process during early mouse embryogenesis [1], [11]. During gastrulation, Id-1, -2, and -3 exhibits specific and distinct patterns of expression, whereas Id-4 is absent. In postmitotic Sertoli cells, Id-1 may act to maintain the growth potential of Sertoli cells, whereas Id-2 and Id-4 may be involved in their differentiation and hormone regulation [12]. These results suggest that Id genes are differentially regulated and have distinct functions. However, the ovarian hormonal regulation and distribution of Id genes in highly dynamic uterine tissue are yet to be fully elucidated.

In our previous work, we profiled the early and late responsive genes regulated by estrogen (E2) in uteri of adult ovariectomized (OVX) mice using cDNA microarray analysis [13] and showed that Id-1 transcript was significantly upregulated by E2 treatment. To improve the understanding of hormonal regulation of Id family gene in the mouse uterus, we here examined the effect of administration of steroid hormones to adult OVX mice on Id family gene and the expression levels of Id-1 at both implantation and inter-implantation sites during the implantation period. Our present results suggest that E2, not P4 is a key regulator of Id-1 expression via classical estrogen receptor (ER) genomic pathway.

Back to Article Outline

2. Methods 

2.1. Animal and uterus preparation 

ICR mice were housed in temperature- and light-controlled conditions. All animal experiments were performed in accordance with the Guide of Ulsan University for Care and Use of Laboratory Animals. To examine the effects of ovarian steroid hormones on Id-1 mRNA expression in the nonpregnant mouse uterus, adult female mice (6–7 weeks old) were OVX and then rested for 14 days before receiving hormone treatment. Short-term effects of ovarian steroid hormones were determined by administering single injections of E2 (300 ng/mouse subcutaneously in sesame oil; Sigma), progesterone (P4, 1 mg/mouse subcutaneously in sesame oil; Sigma), sesame oil (0.1 ml subcutaneously, vehicle control; Sigma), a combination of E2 and P4, and ICI 182,780 (pure antiestrogen; 500 ng/mouse subcutaneously in sesame oil; Tocris Cookson) followed 30 min later by injection with E2 (300 ng/mouse). Mice injected with E2 were killed at 2, 4, 6, or 12 h, (n = 4 mice per group). Half of the uterus was immediately frozen in liquid nitrogen for RNA isolation and the remaining tissues were embedded in optimum cutting temperature (OCT) compound for cryosection.

To obtain pregnant mice, adult female mice (6–8 weeks old) were placed with fertile males of the same strain, and the day that a vaginal plug found was considered as day 1 of pregnancy. On the evening of day 4 (2200–2300 h) at the time of blastocyst attachment, implantation sites were visualized by intravenous injection of Chicago Blue B solution 10 min before killing the mice. Implantation segments containing implanting embryo were finely separated from non-implantation segments, and both segments were then snap frozen in liquid nitrogen for total RNA extraction (n = 4 mice per group).

2.2. Oocytes and embryo collection 

The female mice (10–12 week old) were superovulated by intraperitoneal injection of 5 IU of pregnant mare's serum gonadotrophin (PMSG, Sigma) followed by human chorionic gonadotrophin (hCG, Sigma) 48 h later. Oocytes at metaphase I (GV oocytes) were collected from unstimulated female mice. Oocytes at metaphase II (MII, ovulated oocytes) were collected from the ampullae of the oviducts by tearing with a fine forceps at 18 h after the hCG injection. Embryos of 1-cell, 2-cell, 4-cell, 8-cell, morula, and blastocyst stage were collected from either the oviduct or uterus at 20, 48, 54, 65, 72, and 96 h after the hCG injection, respectively.

2.3. Laser capture microdissection 

Laser capture microdissection (LCM) was performed as previously described [13]. Briefly, after six-micron-thick uterine cryosections were stained with Mayer's hematoxylin, luminal epithelial (LE), stromal (S), and muscle (M) cells were isolated from these sections using the P.A.L.M. Robot-Microbeam version 4.0 (P.A.L.M. Microlaser Technologies). For each cell, an average of 150–200 laser shots were transferred onto a 0.5-ml tube cap and stored at −70 °C until utilized for total RNA extraction. For each laser shot the laser spot size was approximately 30 × 30 μm2 for LE cells and 50 × 50 μm2 for S and M cells.

2.4. Semi-quantitative RT-PCR analysis 

Total RNA from whole uterine tissues, oocytes and preimplantation embryos was purified using an RNeasy total RNA isolation kit (Qiagen). One microgram of RNA was reverse transcribed (RT) at 42 °C for 60 min in a 20 μl reaction mixture consisting of oligo (dT)-adapter primer and AMV reverse transcriptase XL (Takara). Total RNA from LCM-captured luminal epithelial, stromal, and muscle cells was extracted using an RNeasy mini spin column (Qiagen) as previously described [13]. The number of cycles was tested to assess the best conditions to achieve linear amplification and the sequences of the primers used in the RT-PCR are listed in Table 1. The thermal cycling parameters consisted of denaturing at 94 °C, for 30 s, annealing at 60 °C, for 30 s, and extension at 72 °C, for 30 s. The PCR products were separated by electrophoresis and quantified using densitometric scanning and BioID image analysis software (Vilber-Lourmat), and gene expression was normalized against the density of the corresponding ribosomal protein L-7 (rpL7) PCR product as an internal control.

Table 1. Primer sequences for RT-PCR and real-time PCR.
GeneSequencesbp
Id-1FGATCATGAAGGTCGCCAGTG703
RTCCATCTGGTCCTCAGTGC
Id-2FGTGACCAAGATGGAAATCCT523
RTTTATTTAGCCACAGAGTAC
Id-3FGAAGGCGCTGAGCCCGGTGC383
RGTTCGGGAGGTGCCAGGACG
Id-4FGCGATATGAACGACTGCTAC616
RTCACCCTGCTTGTTCACGGC
HB-EGFFCTCCTCCAAGCCACAAGGCC389
RCTAGCCACGCCCAACTTCAC
LFFAGGAAAGCCCCCCTACAAAC276
RGGAACACAGCTCTTTGAGAAGAAC
β-actinFGTGGGCCGCTCTAGGCACCAA539
RCTCTTTGATGTCACGCACGATTTC
rpL7FTCAATGGAGTAAGCCCAAAG246
RCAAGAGACCGAGCAATCAAG

2.5. Quantitative real-time PCR 

Real-time PCR was performed as previously described [14]. Briefly, first-strand cDNA was synthesized from 2 μg of total RNA for real-time PCR using AMV reverse transcriptase XL with dT12–18 primer at 42 °C for 60 min. Real-time PCR was performed in an ABI Prism 7000 Sequence Detector (Applied Biosystems) using SYBR Green PCR Master Mix reagent (Applied Biosystems). PCR conditions were 50 °C for 2 min and 95 °C for 10 min, followed by 40 cycles of 95 °C for 15 s and 60 °C for 1 min. The expression levels of each gene were normalized to rpL7.

2.6. Immunofluorescent antibody labeling 

Oocytes or preimplantation embryos were fixed in 2% paraformaldehyde for 15 min at room temperature. They were then permeabilized with 0.4% Triton X-100 (Sigma) in PBS containing 2% fetal bovine serum for 15 min at room temperature followed by a final treatment for 30 min with blocking solution. After washing in PBS, they were incubated at 4 °C overnight with a 1:500 dilution of Id-1 antibody (Santa Cruz). After primary antibody treatment, they were incubated for 2 h at 4 °C in a 1:500 dilution of fluorescein isothiocyanate (FITC)-conjugated goat anti-rabbit IgG (Santa Cruz). They were counterstained with 4,6-diamidino-2-phenylindole (DAPI) and viewed with immunofluorescence microscope (BX-40, Olympus).

Back to Article Outline

3. Results 

3.1. E2 induced expression of Id-1 is mediated via classical ER genomic pathway, but not altered by P4 

Previous cDNA microarray data showed that while Id-1 transcripts were significantly upregulated in OVX mice uterus exposed to E2 for 12 h, Id-2 and Id-3 transcripts were significantly downregulated (Fig. 1A). However, Id-4 did not respond. For the better understanding for hormonal regulation of Id family genes (Id1-4) in uterus, we first confirmed the microarray data using RT-PCR. The expression patterns of the Id family genes (Id1-4) were investigated in adult OVX mice exposed to E2. To validate the estrogenic efficiency of E2-treated uterus, the samples were tested by expression pattern of known early and late E2-responsive genes, which are heparin binding-epidermal growth factor (HB-EGF) and lactoferrin (LF) (Fig. 1B) [15], [16]. While the expression level of Id-1 mRNA was rapidly increased at 2 h and remained to similar level through 12 h after the injection of E2, Id-2 and Id-3 mRNAs exhibited the same decreased pattern as shown in microarray data (Fig. 1C). These changes by treatment with E2 were statistically significant as compared to vehicle alone. Id-4 mRNA was not detected in either oil- or E2-treated mice uteri. To determine whether the Id-1 mRNA expression is mediated by the estrogen receptor (ER), we next examined the level of Id-1 mRNA in OVX mice uteri after an injection of oil, or E2 with or without ICI 182,780 (ER antagonist). Treatment of mice with ICI 182,780 prior to the injection of E2 significantly decreased the expression level of Id-1 mRNA at 6 hand 12 h after the injection (Fig. 1D). Since E2 interacts with P4 synergistically or antagonistically during the estrous cycle and implantation period, we examined whether the effect of E2 on Id-1 mRNA expression could be enhanced or suppressed by P4 in OVX mice. As expected, the level of Id-1 mRNA was low in oil-treated uterine samples, and this was upregulated by E2. In contrast, treatment with P4 alone or with E2 failed to show any remarkable change on the level of Id-1 mRNA (Fig. 1E). LCM allows the isolation of specific uterine cell types without contamination from other cell types [13]. Representative frozen sections of OVX mice uteri exposed to E2, and subsequent microdissections of specific uterine cells (LE (a–c), M (d–f), and S (g–i)) are shown in Fig. 1F. LCM revealed that while Id-1 mRNA was exclusively expressed in LE cells, it was not detected in either M or S cells (Fig. 1G). These findings demonstrate that E2-induced uterine expression of Id-1 is mediated by a classical ER genomic pathway in LE cells, but not altered by P4.

  • View full-size image.
  • Fig. 1 

    Estrogen-regulated expression of Id gene family in the mouse uterus. (A) cDNA microarray analysis for change of Id gene expression in uteri of OVX mice exposed by E2 for 6 h and 12 h. (B) Validation for the estrogenic efficiency of E2-treated uterus by expression pattern of known early and late E2-responsive genes (HB-EGF and LF). (C) RT-PCR analysis for Id gene expression in uteri of OVX mice exposed by E2 for 2, 4, 6, and 12 h (D and E) Effects of ICI (D) and P4 (E) on Id-1 expression in uteri of OVX mice. (F) Laser capture microdissection (LCM) procedure. Capture of LE (a–c), M (d–f), and S (g–i) cells from OVX mice uteri exposed to E2. Capture sites of each uterine cell were indicated by arrowhead. (G) Distribution of Id-1 mRNA in specific uterine cell types obtained from OVX mice uteri exposed to E2. Adult OVX mice were given a single injection of oil (vehicle, dashed line), E2, E2 plus P4 or ICI or were given ICI before the injection of E2. Abbreviation, ND, not detected; E2, estrogen; P4, progesterone; ICI (ICI 182,780); E, luminal epithelium; M, Muscle; S, Stroma. All bars indicate as the average and standard deviation from three independent experiments. Relative expression levels were calculated with respect to vehicle control. *P < 0.05, **P < 0.01.

3.2. Up-regulation of Id-1 mRNA expression at the implantation site during blastocyst attachment 

The initial attachment reaction between the uterine luminal epithelium and the blastocysts in mice occurs at 2200–2300 h on day 4 of pregnancy, and is marked by a localized increase in endometrial vascular permeability around the blastocysts. Thus, implantation and inter-implantation sites were easily identified by Chicago blue dye injection via a tail vein. To compare Id-1 expression level at implantation and inter-implantation sites on day 4.5 of pregnancy (vaginal plug = day 1) in mouse, we accurately isolated both sites and carried out quantitative real-time PCR (Fig. 2A). Our results showed that the level of Id-1 mRNA was significantly increased at implantation sites as compared with inter-implantation sites (Fig. 2B and C). To determine the developmental stage-specific expression patterns and the relative changes of Id-1 transcript in oocytes and preimplantation mouse embryos, we performed RT-PCR analysis. Id-1 mRNA were detected in the GV oocytes, but not in the ovulated oocytes (MII), 1-cell (PN) and 2-cell embryos. Although the levels of Id-1 in 4- and 8-cell embryos were significantly lower than the levels in GV oocytes, it was induced by zygotic gene activation at 2-cell embryos and highly increased at the morula or the blastocyst stage (Fig. 2D). Next, we performed immunostaining of Id-1 protein to examine the physical location and expression in oocytes and preimplantation embryos. Id-1 was localized in the cytoplasm of all stages and not in the nucleus (Fig. 2E). In addition, it does not appear to be a significant difference of Id-1 signals between the inner cell mass and the trophectodermal cells. These observations suggest that Id-1 gene has no inhibitory function during preimplantation embryonic development because primary function of Id-1 is the inhibition of DNA binding of HLH transcription factors within the nucleus. Interestingly, while Id-1 mRNAs were not detected from MII to 2-cell embryo stage (Fig. 2D), Id-1 protein was observed in the same period. This indicates the continuous translation of GV oocyte-derived Id-1 transcripts.

  • View full-size image.
  • Fig. 2 

    Temporal expression patterns of Id-1 during implantation period and preimplantation embryo development. (A) On the evening of pregnancy day 4 (2200–2400 h), implantation sites were visualized by increased vascular permeability at the site of blastocyst attachment using intravenous injection of Chicago Blue B solution. (B) RT-PCR for Id-1 expression between implantation (Imp) sites and inter-implantation (Inter) site. HB-EGF is used as positive control for implantation site. (C) Real-time PCR analysis was performed to compare Id-1 expression level between Imp and Inter site, quantitatively (*P < 0.05). Gel electrophoresis and melting-curve analyses were performed to confirm the correct PCR product size and absence of nonspecific bands. (D) Temporal expression patterns of Id-1 mRNA. GV, germinal vesicle oocyte; MII, metaphase II oocyte; PN, pronuclear stage embryo; 2C, 4C, 8C, MO and BL represent two-cell, four-cell, eight-cell, morula, and blastocyst stage embryos, respectively. The amount of pSPTet3 mRNA added was the same (2 × 105 copies) for each stages, the ratio between Id-1 and pSPTet3 products is a relative measure of the amount of the Id-1 mRNA. This experiment was performed three times and the data, which are expressed relative to the amount present in the GV oocyte, are expressed as the average and standard deviation (*P < 0.05). (E) Immunostaining of Id-1 in mouse oocytes and preimplantation embryos. Embryos at various developmental stages were collected and immunostained with Id-1. Immunostaining was carried out three times, and approximately twenty oocytes or embryos were localized in each experiment. The signals were detected with a FITC-conjugated secondary antibody (left panel) and the nucleus was stained with 4,6-diamidino-2-phenylindole (DAPI, center panel). Bright field (BE) photograph was shown in right panel. Scale bars, 20 μm.

Back to Article Outline

4. Discussion 

Id gene are involved in proliferation and differentiation in various cell types [1], [2]. Although uterus is highly proliferative and dynamic tissue under the tight control of ovarian steroid hormones [17], [18], [19], nothing is known about the expression and hormonal regulation of Id genes in uterine physiological events. This study is the first report demonstrating that E2-dependent uterine expression of Id-1 mRNA is not altered by P4 but is mediated by a classical ER genomic pathway in the mouse uterus, while Id-2 and Id-3 was downregulated by E2. This result suggests that Id family genes have unique roles in various cell or tissue types other than simply the inhibition of differentiation. In fact, in Sertoli cells freshly isolated and cultured from rat testis, the expression of Id-1 is downregulated by follicle stimulating hormones (FSH), whereas Id-2 and -3 levels remain unchanged in response to FSH. Interestingly, the expression of Id-4 in Sertoli cells is only detectable after stimulation with FSH or cAMP [12]. In addition, we also observed differential expression patterns of Id genes during preimplantation embryo development (data not shown). This supports the notion that Id genes are differentially regulated by specific factors and have a distinct function in embryogenesis and uterine physiology.

We showed that Id-1 mRNA was highly expressed at implantation sites compared to inter-implantation sites during blastocyst attachment on days 4.5 of pregnancy. Although the functions of the Id-1 gene in the implantation process in mammals have not been studied in detail, several lines of evidence offer possible insights in the role of Id gene in the implantation process. Recent work has shown that the expression of Id-1 is required for correct angiogenesis in the neuroectoderm during embryo development, and particularly that the partial reduction of Id-1 dosage also results in an angiogenic defect in adult mice which blocks the vascularization of tumour xenografts [20]. More interestingly, the extracellular matrix surrounding endothelial cells is thickened in Id-knockout mice indicating that Id expression may regulate the expression of integrin and matrix metalloproteinase 2, which are required for tumour angiogenesis [21], [22]. In addition, the loss of Id function leads to a decrease in vascular endothelial growth factor expression in endothelial cells [20]. In mice, the main distinguishing sign of blastocyst attachment sites is angiogenesis, Therefore, these results suggest that endometrial angiogenesis during the estrous cycle or implantation period might be directly or indirectly regulated by Id-1 under the control of ovarian steroid hormone, because this hormone is a prime modulator of cyclic endometrial changes and an inducer of local factors produced at the time of implantation [17], [18], [19]. Our results strongly suggest that the Id-1 plays an important role in the estrous cycle and the implantation process. Further investigations into angiogenic regulation may be necessary to understand the exact mechanisms underlying the effects of the Id-1 gene on the estrous cycle and early pregnancy period.

Back to Article Outline

Acknowledgements 

This work was supported by the research grants from the Asan Institute for Life Sciences (Grant number 2004-116).

Back to Article Outline

References 

  1. Yokota Y. Id and development. Oncogene. 2001;20:8290–8298
  2. Massari ME, Murre C. Helix–loop–helix proteins: regulators of transcription in eukaryotic organisms. Mol Cell Biol. 2001;20:429–440
  3. Murre C, Bain G, van Dijk MA, Engel I, Furnari BA, Massari ME, et al. Structure and function of helix–loop–helix proteins. Biochim Biophys Acta. 1994;12:129–135
  4. Ephrussi A, Church GM, Tonegawa S, Gilbert W. B lineage-specific interactions of an immunoglobulin enhancer with cellular factors in vivo. Science. 1985;227:134–140
  5. Benezra R, Davis RL, Lockshon D, Turner DL, Weintraub H. The protein Id: a negative regulator of helix–loop–helix DAN binding proteins. Cell. 1990;61:49–59
  6. Sun XH, Copeland NG, Jenkins NA, Baltimore D. Id proteins Id1 and Id2 selectively inhibit DNA binding by one class of helix–loop–helix proteins. Mol Cell Biol. 1991;11:5603–5611
  7. Christy BA, Sanders LK, Lau LF, Copeland NG, Jenkins NA, Nathans D. An Id-related helix–loop–helix protein encoded by a growth factor-inducible gene. Proc Natl Acad Sci USA. 1991;88:1815–1819
  8. Riechmann V, Van Cruchten I, Sablizky F. The expression pattern of Id4, a novel dominant negative helix–loop–helix protein, is distinct from Id1, Id2 and Id3. Nucleic Acids Res. 1994;22:749–755
  9. Norton JD. ID helix–loop–helix proteins in cell growth, differentiation and tumorigenesis. J Cell Sci. 2000;113:3897–3905
  10. Takeda T, Sakata M, Isobe A, Yamamoto T, Nishimoto F, Minekawa R, et al. Involvement of Sp-1 in the regulation of the Id-1 gene during trophoblast cell differentiation. Placenta. 2007;28:192–198
  11. Jen Y, Manova K, Benezra R. Expression patterns of Id1, Id2 and Id3 are highly related but distinct from that of Id4 during mouse embryogenesis. Dev Dyn. 1996;207:235–252
  12. Chaudhary J, Johnson J, Kim G, Skinner MK. Hormonal regulation and differential actions of the helix–loop–helix transcriptional inhibitors of differentiation (Id1, Id2, Id3, and Id4) in Sertoli cells. Endocrinology. 2001;142:1727–1736
  13. Hong SH, Nah HY, Lee JY, Kim CH, Gye MC, Kim MK. Analysis of estrogen-regulated genes in mouse uterus using cDNA microarray and laser capture microdissection. J Endocrinol. 2004;181:157–167
  14. Hong SH, Nah HY, Lee YJ, Lee JW, Gye MC, Kim CH, et al. Estrogen regulates the expression of small proline-rich protein 2 family gene in the mouse uterus. Mol Cells. 2004;17:477–484
  15. Wang XN, Das SK, Damm D, Klagsbrun M, Abraham JA, Dey SK. Differential regulation of heparin-binding epidermal growth factor-like growth factor in the adult ovariectomized mouse uterus by progesterone and estrogen. Endocrinology. 1994;135:1264–1271
  16. Das SK, Tan J, Johnson DC, Dey SK. Differential spatiotemporal regulation of lactoferrin and progesterone receptor genes in the mouse uterus by primary estrogen, catechol estrogen, and xenoestrogen. Endocrinology. 1998;139:2905–2915
  17. Ma W, Song H, Das SK, Paria BC, Dey SK. Estrogen is a critical determinant that specifies the duration of the window of uterine receptivity for implantation. Proc Natl Acad Sci USA. 2003;100:2963–2968
  18. Reese J, Das SK, Paria BC, Lim H, Matsumoto H, Knudtson K, et al. Global gene expression analysis to identify molecular marker of uterine receptivity and embryo implantation. J Biol Chem. 2001;276:44137–44145
  19. Mardon HJ, Bagchi MK, Bagchi IC, Peng C, Karpovich N, Wang Y. Hormonal and paracrine regulation of embryonic implantation: a workshop report. Placenta. 2007;(Suppl. A):S82–S84
  20. Lyden D, Young AZ, Zagzag D, Yan W, Gerald W, O'Reilly R, et al. Id1 and Id3 are required for neurogenesis, angiogenesis and vascularization of tumour xenografts. Nature. 1999;401:670–677
  21. Brooks PC, Montgomery AM, Rosenfeld M, Reisfeld RA, Hu T, Klier G, et al. Localization of matrix metalloproteinase MMP2 to the surface of invasive cells by interaction with integrin alpha beta v3. Cell. 1996;79:1157–1164
  22. Silletti S, Kessler T, Goldberg J, Boger DL, Cheresh DA. Disruption of matrix metalloproteinase 2 binding to integrin alpha vbeta 3 by an organic molecule inhibits angiogenesis and tumor growth in vivo. Proc Natl Acad Sci USA. 2001;98:119–124

PII: S0143-4004(09)00378-6

doi:10.1016/j.placenta.2009.11.015

Placenta
Volume 31, Issue 3 , Pages 240-244, March 2010