Placenta
Volume 31, Issue 4 , Pages 312-319, April 2010

Expression and Transcriptional Regulation of Individual Pregnancy-specific Glycoprotein Genes in Differentiating Trophoblast Cells

Departamento de Bioquímica Clínica, Facultad de Ciencias Químicas, CIBICI-CONICET, Universidad Nacional de Córdoba, Haya de la Torre y Medina Allende, X5000HUA Córdoba, Argentina

Accepted 5 January 2010. published online 29 January 2010.

Article Outline

Abstract 

Human pregnancy-specific glycoproteins (PSGs), encoded by eleven highly conserved genes, are the major placental polypeptides. Low PSG levels in maternal circulation have been associated with complicated pregnancies. However, expression of each PSG gene and their regulation during cytotrophoblast cell differentiation remain poorly explored. Herein, we analyze the expression of five PSG genes and demonstrate that they are almost undetectable in undifferentiated trophoblast, but are all transcribed in differentiated cells. Among them, PSG1, PSG3 and PSG5 genes achieve high mRNA levels while PSG7 and PSG9 are poorly expressed. In addition, total PSG proteins and transcripts markedly increase during trophoblast differentiation, preceding morphological syncytialization and βhCG expression. The 5′ regulatory region contributes to the transcriptional control of PSG gene induction in trophoblast cells undergoing differentiation. This responsive region in PSG3 maps within a 130bp promoter sequence, which overlaps the transcription start site and requires a functional Retinoic Acid Responsive Element (RARE) and a GA-binding protein (GABP) consensus site for basal and differentiation-dependent promoter activity, respectively.

Present findings provide novel data for understanding the control of PSG gene expression and demonstrate that their proteins and transcripts represent early markers of trophoblast differentiation.

Keywords: Transcription, PSG, Gene family, Trophoblast differentiation

 

Back to Article Outline

1. Introduction 

Cellular differentiation involves the interaction of endogenous gene expression programs and external signals given by hormones, growth factors and cell–cell contacts, among many other factors. During placental development, the trophectoderm of the blastocyst originates the villous cytotrophoblast (CTB) and the invasive extravillous CTB. Villous CTBs proliferate and fuse into the syncytiotrophoblast (STB) layer, which constitutes the uninterrupted, multinucleated epithelium-like surface of the placental villous that separates the maternal blood from the villous interior. The extravillous CTBs aggregate and invade the uterine wall up to the inner third of the myometrium [1]. Abnormalities in this developmental process have been correlated with placental pathologies such as early and mid-trimester pregnancy loss, preeclampsia, intrauterine growth retardation and gestational diabetes [2], [3], [4].

Pregnancy-specific glycoprotein (PSG) genes are expressed in placenta throughout gestation and are the most abundant placental proteins found in the maternal circulation in late pregnancy. The clinical relevance of measuring PSG in maternal serum was already suggested three decades ago. Low PSG levels in maternal circulation were associated with certain pregnancy complications such as intrauterine growth retardation, preeclampsia and spontaneous abortion [5], [6], [7], [8]. In humans, the family is composed of 11 highly similar genes clustered within 700-kilobases on chromosome 19q13.2 [9]. They encode very similar secreted proteins containing a leader peptide (L), one immunoglobulin V-like domain (N), immunoglobulin C2-like domains (A and B) and a short variable carboxy-terminal tail (C). Several studies have determined that PSG proteins cover immuno-regulatory functions. They induce monocytes to synthesize anti-inflammatory cytokines and promote alternative macrophage activation which correlates with the shift from Th1- to Th2-mediated immunological responses [10], [11], [12]. PSG protein participation in immune-modulation and T-cell function is reinforced by the fact that elevated PSGs are correlated with improved symptoms of rheumatoid arthritis [13] and multiple sclerosis [14]. Previous studies in placenta have shown that although the intensity of PSG protein immunostaining was higher in preterm than in term placentas [15], total PSG mRNA was found to be elevated in term compared to preterm placenta. Furthermore, a time-dependent increase in PSG1 expression was observed in in vitro differentiated STB cells suggesting a role for PSG1 in this process [16], [17]. However, the molecular clues involved in the expression of each PSG gene during normal villous CTB cell differentiation remain poorly explored.

Human PSG promoters are highly similar; all of them lack a TATA-box, a pyrimidine-rich initiator element and large GC regions [18], [19]. We have previously demonstrated that PSG5 promoter is active in placental as well as in non-placental cell lines, it is down-regulated by promoter selective repressor sequences, and its transcription is largely dependent on a core promoter element (CPE) [20], [21]. In addition, we have reported the Sp1 (Specificity protein 1), KLF4 (Krüppel-like transcription factor 4) and RXRα (Retinoid X receptor alpha) contribution to PSG5 gene transcription [22], [23], [24].

Herein, we demonstrate that: a) the expression of PSG genes is an early marker of human trophoblast differentiation into the syncytium pathway; b) PSG1, PSG3, PSG5, PSG7 and PSG9 transcripts increase in CTBs undergoing differentiation; c) the proximal promoter sequence mediates PSG transcriptional activation during trophoblast syncytialization. In addition, present results indicate that RARE is required for basal PSG3 transcription and the GABP consensus-binding site contributes to the transcriptional activation associated with trophoblast differentiation.

Back to Article Outline

2. Materials and methods 

2.1. Cytotrophoblast isolation, cell culture and differentiation 

Tissues from normal term placentas (37–41 weeks of pregnancy) were obtained after natural delivery and processed within 30min, as previously described [25]. They were collected from unidentified patients with the approval of the Human Studies Committee of the Hospital Privado of Córdoba, Argentina.

CTBs were isolated according to the protocol of Kliman [26]. Isolated trophoblasts (at least 97% cytokeratin 7-positive cells) were plated in keratinocyte growth medium (KGM) (Invitrogen) supplemented with 10% foetal calf serum (FCS) and 100U/ml penicillin/0.1mg/mL streptomycin. After 4h, cells were washed and adhered cells were cultivated in complete growth medium as described [25].

JEG-3, COS-7, and HeLa cell lines were grown in Dulbecco's modified Eagle's medium supplemented with antibiotics and 10% FCS. After overnight incubation, cells were cultured for a further 4 days in the presence of 1μM methotrexate (Mtx) to induce in vitro differentiation. Medium was changed every 24h.

2.2. Immunofluorescence assays 

Isolated CTB and JEG-3 cells were cultured on cover slips using supplemented medium as described above and immunofluorescence assays were performed as previously reported [25]. The following primary antibodies were used: polyclonal rabbit anti-PSG (A0131, Dako) 1/100, mouse anti-desmosomal protein (0.045mg/mL, ZK-31, Sigma Chemical Co.), polyclonal rabbit anti-human chorionic gonadotropin (hCG, A0231, Dako) 1/500 and mouse monoclonal anti-cytokeratin 7 (Dako, Clone OV-TL 12/30). Cells were the incubated with the appropriate species-specific secondary antibodies, red Alexa Fluor 594-conjugated goat anti-mouse IgG or green Alexa Fluor 488-conjugated donkey anti-rabbit IgG (Molecular Probes, Inc., Eugene, OR) in a 1/720 final dilution. All antibody incubations were carried out in a humidity chamber for 1h at 37°C. Observations were made with an optical microscope (Nikon Eclipse TE2000-U, USA).

2.3. Western blotting 

Electrophoresis and blotting was performed as previously described [25]. Briefly, membranes were probed with polyclonal rabbit anti-PSG (A0131, Dako) 1/500 or mouse monoclonal anti-α-tubulin (Sigma–Aldrich) 1/1000. Incubations were performed 1h at room temperature in 1× TBS-T (100mM Tris-HCl pH 7.8, 750mM NaCl and 0.1%v/v Tween 20) and 5% (w/v) non-fat milk. After washing, blots were incubated with horseradish peroxidase-conjugated donkey anti-rabbit or sheep anti-mouse secondary antibodies (Amersham Bioscience) at room temperature for 1h diluted 1/5000 in 1× TBS-T.

2.4. Semi-quantitative and qRT-PCR 

Total RNA was purified using Trizol (Invitrogen). One microgram of total RNA was reverse-transcribed in a total volume of 20μl with random primers and M-MLV reverse transcriptase (Promega).

Semi-quantitative and qRT-PCR were performed using the PCR primers listed in Table 1. PSG forward primers were designed to prime in the first exon (5′ UTR and leader peptide) and reverse primers within the second exon (leader peptide and N domain) of each PSG member. For total PSG mRNA amplification, the selected PCR primers were complementary to sequences conserved in all but two PSG transcript variants, which lack the N domain. For individual PSG gene amplification, each primer pair had at least two mismatches with the non-specific PSG targets near the 3′ end. Primers were manually designed with the assistance of the Netprimer software (PREMIER Biosoft International) and Primer Express software (ABI); selected sequences were compared against the human genomic and transcript database with the BLAST program [27] at the NCBI Web site (http://blast.ncbi.nlm.nih.gov/Blast.cgi). Primers for βhCG were as described in [28]. Conventional PCR conditions were optimized to allow detection in the exponential reaction phase and included an annealing temperature of 60°C, 1.5mM Mg2+ and the primer concentrations indicated in Table 1. Individual and total PSG transcripts were quantified by real-time RT-PCR (ABI 7500 Sequence Detection System, Applied Biosystems) with Sequence Detection Software v1.4. Experiments were performed using 1× SYBR Green PCR Master Mix (Applied Biosystems) and the primer concentrations indicated in Table 1. Specificity was verified by melting curve analysis and agarose gel electrophoresis and was confirmed through direct DNA sequencing (Macrogen Inc, Seul, Korea). Fold change in total PSG expression was calculated according to the 2-ΔΔCt method as described [25]. No amplification was observed in PCR reactions containing water or RNA samples incubated without reverse transcriptase during cDNA synthesis.

Table 1. Primer sequences, amplicon size and primer concentrations used in PCR assays.
PrimerTargetSequence 5′→3′Amplicon size (bp)Primer concentration in semi-quantitative PCR (μM)Primer concentration in Q-PCR (μM)
tPSG FtotalCCTCTCAGCCCCTCCCTG
tPSG RPSGGGCAAATTGTGGACAAGTAGAAGA1650.250.1

PSG1FPSG1TGCACACAGCGCATCAAA
PSGR CTCCTCTAGTCCCATCATCTCC3750.250.25

PSGFPSG3CCTCTCAGCCCCTCCCT
PSG3R GTGAAGGTGAAATGTCCAGTTT4130.25–

qPSG3FPSG3TGGTCCAGACCTCCCCAGAATT
qPSG3R CCAGGAAGATGTCCTGTTCC282–0.1

PSGFPSG5CCTCTCAGCCCCTCCCT
PSG5R TACTCCTCTAGTCCTATCACCTCG3930.25–

qPSG5FPSG5CAAGTCACGATTGAAGCCCT
PSG5R TACTCCTCTAGTCCTATCACCTCG300–0.25

PSG7FPSG7CACACAGCATATAACCTGGAAA
PSG7R ATCCTGTGTCTTCCTGGGTG3270.25–

PSG7FPSG7CACACAGCATATAACCTGGAAA 0.25
qPSG7R GGCAAATTGTGGACAAGTAGAAGA158–0.1

PSG9FPSG9CCTCCCAGCCCCTTCC
PSG9R GGTGTAGGTTCCTGCATCCTT3550.25–

qPSG9FPSG9TCCTGCTCACAGCATCACTTTT
PSG9R GGTGTAGGTTCCTGCATCCTT310–0.1

GAPDHFGAPDHGGTGAAGGTCGGAGTCAACG
GAPDHR GATCTCGCTCCTGGAAGATGG2360.25–

Relative mRNA abundance among measured PSGs was calculated using the inverse of PCR efficiency rised to the power of the difference between the target PSG gene Ct and the cyclophilin A control gene Ct. Efficiency was determined by [10(-1/Slope)] of the relative standard curve for each amplicon. Relative mRNA abundance was expressed as % of total PSG mRNA [29].

2.5. Construction of reporter plasmids 

The 5′ proximal regulatory and promoter region of PSG3, PSG5, and PSG7 were isolated from genomic DNA by PCR, purified and cloned into pGL3-basic vector to obtain PB3-luc, PB5-luc and PB7-luc constructs, harbouring sequences corresponding to positions – 613/−49, −605/−49, and −638/−49, respectively (Fig. 4). Different 5′ end positions are due to a different number of TG repeats present in each gene. PSG5 promoter region (−251/−49) was amplified and cloned into pGL3-basic to obtain the UB5-luc construct. The PSG3 promoter region (−251/−49) was subcloned from PB3-luc by restriction deletion to create UB3-luc, and NB3-luc (−178/−49 of PSG3 promoter) was obtained through PCR amplification, restriction digestion and subcloning into pGL3-basic. mRARE PB3-luc and mGABP PB3-luc are derivative mutants of PB3-luc obtained by PCR-directed mutagenesis of the RARE (GTGTCCTGGGCCTGACCCCG to GTGTCCTGGGCCTtctagaC) and GABP (GCCCCGGGAAGAGGC to GCCCgGtaccGAGGC) binding sites, respectively (consensus sequences are underlined and mutated bases are shown in lower case). All constructs were verified by DNA sequencing.

2.6. Transient transfection assays 

Isolated trophoblasts were seeded at a density of 3×105 cells per well in 24-well plates. After 12h, the medium was changed and cells were either immediately transfected or cultivated for additional 36h before supplementation with gene transfer reagents. Transient transfections were performed in a final volume of 100μl serum-free OPTI-MEM growth medium (Invitrogen) containing 1μl of Lipofectamine (2000) (Invitrogen), 1425 ng of the indicated PSG reporter construct and 75ng of the Renilla pRL-TK vector (Promega) to correct for transfection efficiency. At 4h post-transfection, medium was replaced with KGM containing 10% FCS and 5ng/μL EGF plus antibiotics. After additional 24h, cellular protein lysates were prepared in 100μl of the passive lysis buffer. As controls, cells were transfected with pGL3-basic or SV40-promoter luciferase vectors.

JEG-3 cells were seeded at a density of 1×105 per well in 24-well plates, cultured for 24h and afterwards transfected with 2μl of Lipofectamine (2000), 620ng of the indicated PSG reporter construct and 30ng of pRL-TK. After 4h, medium was replaced with DMEM-10% FCS and antibiotics alone or supplemented with 1μM Mtx. Protein extracts were prepared 24h post-treatment. Luciferase and Renilla activities were measured in 10μl of protein extracts on a GloMax-Multi Detection System using the Dual-Luciferase Reporter Assay System (Promega). Luciferase activity was divided by Renilla activity in each cell extract (RLU). Relative promoter activity was calculated as the RLU of each promoter construct divided the RLU of samples transfected with pGL3-basic. Activation fold was expressed relative to the promoter activity of each construct in undifferentiated cells. Since different vector-dependent basal luciferase activity was observed in the differentiated vs undifferentiated cultures, they were subtracted from the corresponding construct RLUs before calculating activation fold.

2.7. Statistical analysis 

Data are expressed as mean±SEM of at least three experiments performed in triplicates. Significant differences for each construction activity between the undifferentiated vs differentiated condition or between two constructions were identified using two-sided Student's t-test. p<0.05 was considered to be statistically significant.

Back to Article Outline

3. Results 

3.1. PSG transcripts and proteins increase in trophoblast cells undergoing differentiation 

Two different trophoblast cell systems were employed, primary CTBs and choriocarcinoma JEG-3 cells. In vitro differentiation of term villous CTBs is a useful model to study CTB syncytialization [30]. However, we aimed to employ a cell line-based system, which offers the advantage of unconstrained cell access to perform experiments under controlled conditions. It had been demonstrated that the treatment of JEG-3 with Mtx inhibits cell growth and increases hCG production [31]. Therefore, we test if it was an appropriate model to study differentiation-dependent PSG gene expression.

Morphological syncytialization of treated JEG-3 cells was confirmed by desmosomal protein staining, which progressively disappeared at the intercellular boundaries as syncytium-like structures were formed in a time-dependent manner (Fig. 1A). In undifferentiated JEG-3 cells, total PSG transcripts and proteins were low or undetectable but Mtx-induced differentiation resulted in a time-dependent increase (Fig. 1B and C). To confirm that activation of PSG expression was associated with trophoblast cell differentiation and was not due to a direct effect of Mtx, similar experiments were done in COS-7 and HeLa cells. Even though Mtx treatment promoted cell size increase, there were no signs of either cellular fusion or PSG transcript and protein activation (data not shown).

  • View full-size image.
  • Fig. 1 

    Total PSG transcripts and proteins increase in JEG-3 cells undergoing differentiation. A) Immunostaining of fixed cells with anti-desmosomal protein (red) and nuclear counterstaining with Höechst (blue). Bar=10μm. Original magnifications: top panel ×200, bottom panel ×1000. B) Semi-quantitative RT-PCR of total PSG transcripts (tPSG). C) Western blot for total PSG proteins (100μg). The blots shown correspond to one representative experiment of three with similar results. Induction fold was calculated after dividing the density value obtained for PSG mRNA or protein expression by the value obtained for the corresponding internal control (GAPDH mRNA and α-tubulin, respectively). Basal expression was arbitrarily set as 1 and values represent the mean±SEM of three independent experiments. [For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.]

In freshly isolated CTBs, PSG transcripts were very low or undetectable and markedly increased after 96h of in vitro differentiation (Fig. 2A, top panel). Simultaneous evaluation of total PSG and βhCG transcripts revealed that both were expressed after 24h; instead only PSG mRNA was clearly detected after 16h (Fig. 2A). A 101±29 -fold induction (mean±SEM) of total PSG transcripts was observed on CTB RNA samples purified from four different placentas and differentiated for 96h. PSG protein expression also augmented upon differentiation (Fig. 2B) reaching expression levels remarkably higher than those observed in differentiated JEG-3. Immunofluorescence assays revealed PSG protein expression in the context of CTB morphological differentiation. Staining was undetectable in 4h CTB cultures but became evident after 16h, before formation of the syncytium-like structures, and further increased with culture time (Fig. 2C). In addition, βhCG immunostaining confirmed that PSG protein expression also precedes βhCG synthesis (Fig. 2D). Altogether, these results indicate that total PSG transcript and protein induction represents an early biochemical marker associated with trophoblast cell differentiation.

  • View full-size image.
  • Fig. 2 

    Total PSG transcripts and proteins increase in differentiated CTBs. A) Semi-quantitative RT-PCR of total PSG and βhCG in CTBs differentiated for the indicated hours. A representative experiment of three independent experiments performed from CTBs isolated from three placentas is shown. B) Western blot assay for total PSG proteins (0h, 100μg or 96h, 10μg). C and D) Immunofluorescence detection of PSG (C) or βhCG (D) proteins (green), desmosomal protein (red) and nuclei (blue) in CTBs cultured during 4, 16, 24, 48 and 96h. Asterisk, non-fused CTB expressing PSG proteins. Bar=10μm. Original magnification: ×1000. [For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.]

3.2. mRNA expression of individual PSG genes in differentiated trophoblasts 

Individual PSG member expression study is demanding due to their high degree of sequence identity and the lack of specific antibodies for each PSG protein. Herein, we studied the expression of PSG1, PSG3, PSG5, PSG7 and PSG9 which are evenly distributed along the entire PSG cluster [9]. Specific transcripts for each of the analyzed PSG genes were detected in differentiated JEG-3 and CTBs while they were undetectable or had low expression level in undifferentiated cells (Fig. 3).

  • View full-size image.
  • Fig. 3 

    PSG1, PSG3, PSG5, PSG7, and PSG9 transcripts are up-regulated upon trophoblast differentiation. RT-PCR for the indicated PSG and GAPDH genes were performed with RNA from JEG-3 cells cultured (d) or not (u) in differentiating conditions for 96h, and of isolated CTBs cultured for 4h (u) or 96h (d).

Relative abundance levels were evaluated in differentiated CTBs through qRT-PCR. PSG1, PSG3 and PSG5 transcripts were more abundant than PSG7 and PSG9 mRNAs, and although their abundance varied among samples, the distribution into high and low-expressed mRNAs was maintained (Table 2). The high or low-expressed genes did not group together as more similar when a Clustal alignment of 3000 nucleotides upstream of the first codon was performed (data not shown). Indeed, PSGs share more than 93% nucleotide sequence identity and the most dissimilar region corresponds to a stretch of (TG)n repeats. These motives have a propensity to undergo structural transitions and have been shown to modulate transcription in several genes with an inverse correlation between repeat length and transcriptional levels. In most cases, it was observed that repeats of n≥12 units exert a down regulatory effect on transcription [32]. Nevertheless, present results do not support a potential regulatory function in PSGs since PSG7 and PSG9 contain repeats of more than 12 units and are expressed at lower levels than PSG5 with only 6 repeat units but PSG1 and PSG3, which include 12 and 20 repeat units respectively, were among the highly expressed transcripts (Table 2). Also, transcript level differences among these genes were not associated with a pattern of sequence conservation within the putative regulatory elements previously described for PSG5 [22], [24]. However, we cannot rule out that subtle nucleotide differences may participate in controlling the overall transcription rate and therefore relative abundance of each PSG gene. The data suggest that a fine-tuning complex mechanism that may include specific long-range acting chromatin factors, transcriptional regulation and transcript stability controls the expression of each PSG gene member.

Table 2. Relative mRNA abundance of PSG genes in differentiated cytotrophoblasts.
Gene% Relative PSG gene abundanceaPutative regulatory motives
MedianRange(TG)nRARECPEFP1FP3FP4
PSG16.235.37–31.8520TGTCCTGGGCCTGACCCCCCTGCCCGGGCGTTCAGGGACCTGCACAATGGGG

PSG311.126.34–17.3212TGTCCTGGGCCTGACCCCCCCGCCCGGGCATGCAGGGACCTGCACAATGGGG

PSG520.4615.53–29.186TGTCCTGGGCCTGACCCCCCCACCCGGGCGTGCAGGGACCCGCACAATGGGG

PSG70.630.06–2.2522TGTCCTGGGCCTGACCCCCCCACCCGGGCGTGCAGGGACCTGCACAATGGGG

PSG90.050.01–0.3118TGTCCTGGGACTGACCCCCCCGCCCAGGCATGCAGGGACCTGCACAATGGGG

aValues obtained in samples from five different placentas. Putative regulatory motives previously identified in PSG5 are as follows: (TG)n, stretch of TG repeats; RARE, retinoic acid responsive element; CPE, core promoter element; FP1-4, footprint elements 1, 3 and 4. Nucleotide differences with respect to PSG5 are highlighted in bold.

3.3. Differentiation and transcriptional activation of PSG genes 

In order to establish the contribution of transcriptional control to PSG induction during differentiation, we analyzed the promoter activities of approximately 600bp of the 5′ proximal regulatory regions of two highly expressed (PSG3 and PSG5) and one low-expressed (PSG7) genes. Even though expression of the endogenous transcripts was undetectable in undifferentiated JEG-3 cells, PSG promoter constructs were active in this cell condition (Fig. 4A). When JEG-3 cells were induced to differentiate each PSG construct exhibited a small but significant increase in luciferase activity, but promoter activity of the PSG unrelated SV40 promoter remained constant (Fig. 4B). Thus, response elements located at the 5′ regulatory region mediate specific transcriptional activation upon differentiation of JEG-3 cells.

  • View full-size image.
  • Fig. 4 

    Transcriptional activities of PSG constructs in JEG-3 and CTB cells. Reporter constructs with putative functional regulatory elements are shown on the left, CPE (○), RARE (□), FP1 (♢), FP3 (), FP4 (▵), (TG)n repeat (■) and GABP (⎔). Hatched symbols indicate subtle sequence differences with those previously identified in PSG5 [22], [24]. Mutated elements are in grey. A and B) JEG-3 cells transfected and treated (black bars) or not (grey bars) with 1μM Mtx. C, D and E) early (12h, grey bars) or late (48h, black bars) CTB cultures transfected with the indicated constructs. Results are expressed as relative luciferase activity respect to pGL3-basic (A and C) or respect to the PB3-luc activity in early CTBs (E). For easier comparison between the reporter activities of each construct in both differentiation conditions, results are expressed as activation fold respect to the undifferentiated cultures (B and D). Data from three to five experiments performed in triplicate are shown (mean±SEM). * Statistically significant difference (p<0.05) between the indicated constructs or between each construct in both cells conditions.

Transcriptional control was further investigated in primary CTB cultures. All PSG constructs were active when they were transfected in early cultures (12h) displaying different relative luciferase activity. Pair-wise comparison of UB3-luc vs PB3-luc, and UB5-luc vs PB5-luc, indicated the presence of a functional repressor element located upstream nt −251 (Fig. 4C), as it had been described for PSG5 in non-placental cells [20]. In CTBs differentiated for 48h, PB3-luc and PB5-luc, as well as their UB3-luc and UB5-luc deletion constructs, had higher activities than those displayed in early cultures; in contrast, promoter activity of the low-expressed PSG7 gene and of the PSG unrelated SV40 promoter remained unaffected (Fig. 4D). Further deletion of PSG3 sequences up to position −178 (NB3-luc) revealed that, at least for PSG3, the differentiation responsive element/s should be located within the 130bp promoter sequence (−178/−49). This region contains several consensus DNA binding sites. Among them are a RARE motive and a putative binding site for the Ets-family transcription factor GABP. To explore the contribution of these elements to the enhanced PSG transcription observed in differentiating trophoblasts, we compared the functional activity of the wild-type PB3-luc with the RARE or GABP mutated constructs (Fig. 4E). In early CTB cultures, RARE mutation nearly abolished promoter activity. Instead, there was no significant difference in the transcriptional activity of the GABP mutated construct compared to wild-type PB3-luc (Fig. 4E, grey bars). In more differentiated CTBs, wild-type PB3-luc was clearly activated but the RARE mutant remained inactive and the activity of the GABP mutant did not increase compared to that of PB3-luc in early CTBs (Fig. 4E, black bars). Therefore, the RARE binding site is required for basal promoter activity while the GABP binding site is involved in the induction of PSG3 transcription during differentiation.

In sum, these results confirm that proximal promoter elements contribute to the transcriptional increase of PSG expression associated to trophoblast cell differentiation into the syncytium pathway.

Back to Article Outline

4. Discussion 

The present study was undertaken to gain insight into the expression and transcriptional regulation of PSG genes in differentiating trophoblast cells. Our results confirm and further extend previous reports regarding PSG expression [15], [16], [18], [33]. Herein, we demonstrate that total PSG proteins and transcripts markedly increase in isolated CTBs undergoing differentiation into the syncytium pathway. This induction precedes morphological syncytialization and βhCG expression. Present results support the proposal of PSG as an early biochemical marker of STB formation. Moreover, considering that placental chorionic villous turnover entails the shedding of syncytium material into the maternal circulation and since this process is altered in pathologic pregnancies [34], total PSG transcripts could be regarded as a candidate plasma biomarker of placental function.

As suggested, different PSG members may have different functions [35]. Thus, it is useful to know which members are expressed in trophoblast cells in order to shed light on our understanding of PSG function in human pregnancy. It has been largely assumed that all PSG genes are expressed in placenta. Nevertheless, gene expression analyses have provided controversial results. For instance, expression profiling studies in normal and preeclamptic placenta tissues have identified PSG4, PSG5 and PSG7 as the highly expressed genes in term pregnancies [36], [37]. A microarray survey of 6900 genes in human trophoblast cells differentiating into the syncytium pathway identified PSG1 as the most up-regulated gene [17]. However, this study did not address the relative abundance levels among individual PSG genes. Herein, we designed gene specific primers and established amplification conditions to measure PSG1, PSG3, PSG5, PSG7 and PSG9 transcript levels. Each of the selected genes belongs to one of the blocks that characterize the family cluster [9]. Present data suggest that the whole PSG locus is activated in CTBs that differentiate into the syncytium pathway, although they reach different abundance levels. It is interesting to note that syncytium-like trophoblast cells express very little PSG9 mRNA and, conversely, up-regulation of PSG9 expression, but not any other PSG member, was found in colorectal carcinogenesis [38]. Thus, PSG9 may have a diverse function related to carcinogenesis instead of placental immunomodulation.

The 5′ proximal regulatory regions of the highly expressed PSG3 and PSG5 genes exhibited enhanced transcriptional activity in both differentiation systems, while PSG7 gene was activated in JEG-3 but not in CTB differentiated cells. In addition, PSG transcriptional induction was higher in CTB than JEG-3 cells. Consequently, JEG-3 cells appear as a partially convenient model to perform initial studies on PSG expression. Accordingly, the putative differentiation responsive region was further delimitated through experiments performed on primary cultures. In this cell system, a 130bp promoter sequence overlapping the transcription start site was sufficient to mediate differentiation-associated PSG3 activation. This sequence includes a GABP consensus-binding site which was required for promoter activation in differentiated CTB and a RARE motif necessary for promoter activity in differentiated and undifferentiated CTB. Notably, both elements are highly conserved in all PSG genes. Our data suggest that members of the RXR and Ets transcription factor families potentially contribute to basal and differentiation-dependent PSG transcription, respectively. In this context, Ets transcription factors as Ets-2 (Ets transcription factor subfamily member 2) and Pea3 (polyomavirus enhancer activator 3) are expressed in villous trophoblast, participate in normal placentogenesis and regulate trophoblast gene expression [39], [40]. RXRα is required for normal trophoblast development and it is a known regulator of STB hormone synthesis [41], [42], [43]. Indeed, we had previously demonstrated that RARE mediates PSG5 transcriptional activation by RXRα in JEG-3 and most significantly, the responsiveness to 9-cis retinoic acid was enhanced in JEG-3 cells upon differentiation [24]. Therefore, it is possible to hypothesize that the RARE motif is involved not only in basal promoter activity but also in PSG activation upon trophoblast differentiation; further studies should address this possibility. In addition, it would be interesting to consider the role of Sp1, since the CPE element mediates PSG5 transcriptional activation by Sp1 [22] and the Sp1/Sp3 ubiquitous transcription factors are induced during trophoblast fusion and are critical for STB specific gene expression [44], [45].

Even though our results demonstrate the contribution of the 5′ proximal control region to PSG gene activation, it does not explain by itself their remarkable increase in expression. Hence, transcriptional activation by other regulatory sequences, epigenetic control and/or transcript stability should be considered to fully understand the molecular mechanisms that mediate enhanced expression of PSG genes during trophoblast cell differentiation.

In sum, this report provides novel data regarding the expression of human PSG genes as early markers of trophoblast differentiation and demonstrates the contribution of transcriptional mechanisms to PSG gene activation associated with trophoblast syncytialization.

Back to Article Outline

Acknowledgements 

This work was granted by the Consejo Nacional de Investigaciones Científicas y Técnicas de Argentina (CONICET), the Agencia Nacional de Promoción Científica y Tecnológica (ANPCyT), the Ministerio de Ciencia y Tecnología de la Provincia de Córdoba, and the Secretaría de Ciencia y Tecnología de la Universidad Nacional de Córdoba (SECyT-UNC). S.G.-R. and G.M.P-D. are Career Investigators of CONICET. C.S., R.V. and R.A. thanks CONICET and FONCYT for their fellowships.

Back to Article Outline

References 

  1. Bischof P, Irminger-Finger I. The human cytotrophoblastic cell, a mononuclear chameleon. Int J Biochem Cell Biol. 2005;37:1–16
  2. Huppertz B, Kingdom JC. Apoptosis in the trophoblast – role of apoptosis in placental morphogenesis. J Soc Gynecol Investig. 2004;11:353–362
  3. Kadyrov M, Kingdom JC, Huppertz B. Divergent trophoblast invasion and apoptosis in placental bed spiral arteries from pregnancies complicated by maternal anemia and early-onset preeclampsia/intrauterine growth restriction. Am J Obstet Gynecol. 2006;194:557–563
  4. Pustovrh MC, Jawerbaum A, Capobianco E, White V, Lopez-Costa JJ, Gonzalez E. Increased matrix metalloproteinases 2 and 9 in placenta of diabetic rats at midgestation. Placenta. 2005;26:339–348
  5. Towler CM, Horne CH, Jandial V, Campbell DM, MacGillivray I. Plasma levels of pregnancy-specific beta 1-glycoprotein in complicated pregnancies. Br J Obstet Gynaecol. 1977;84:258–263
  6. Karg NJ, Csaba IF, Than GN, Arany AA, Szabo DG. The prognosis of the possible foetal and placental complications during delivery by measuring maternal serum levels of pregnancy-specific beta-1-glycoprotein (SP1). Arch Gynecol. 1981;231:69–73
  7. Silver RM, Heyborne KD, Leslie KK. Pregnancy specific beta 1 glycoprotein (SP-1) in maternal serum and amniotic fluid; pre-eclampsia, small for gestational age fetus and fetal distress. Placenta. 1993;14:583–589
  8. Arnold LL, Doherty TM, Flor AW, Simon JA, Chou JY, Chan WY, et al. Pregnancy-specific glycoprotein gene expression in recurrent aborters: a potential correlation to interleukin-10 expression. Am J Reprod Immunol. 1999;41:174–182
  9. Teglund S, Olsen A, Khan WN, Frangsmyr L, Hammarstrom S. The pregnancy-specific glycoprotein (PSG) gene cluster on human chromosome 19: fine structure of the 11 PSG genes and identification of 6 new genes forming a third subgroup within the carcinoembryonic antigen (CEA) family. Genomics. 1994;23:669–684
  10. Wessells J, Wessner D, Parsells R, White K, Finkenzeller D, Zimmermann W, et al. Pregnancy specific glycoprotein 18 induces IL-10 expression in murine macrophages. Eur J Immunol. 2000;30:1830–1840
  11. Snyder SK, Wessner DH, Wessells JL, Waterhouse RM, Wahl LM, Zimmermann W, et al. Pregnancy-specific glycoproteins function as immunomodulators by inducing secretion of IL-10, IL-6 and TGF-beta1 by human monocytes. Am J Reprod Immunol. 2001;45:205–216
  12. Motran CC, Diaz FL, Montes CL, Bocco JL, Gruppi A. In vivo expression of recombinant pregnancy-specific glycoprotein 1a induces alternative activation of monocytes and enhances Th2-type immune response. Eur J Immunol. 2003;33:3007–3016
  13. Fialova L, Kohoutova B, Peliskova Z, Malbohan I, Mikulikova L. Serum levels of trophoblast-specific beta-1-globulin (SP1) and alpha-1-fetoprotein (AFP) in pregnant women with rheumatoid arthritis. Cesk Gynekol. 1991;56:166–170
  14. Bebo BF, Dveksler GS. Evidence that pregnancy specific glycoproteins regulate T-Cell function and inflammatory autoimmune disease during pregnancy. Curr Drug Targets Inflamm Allergy. 2005;4:231–237
  15. Zhou GQ, Baranov V, Zimmermann W, Grunert F, Erhard B, Mincheva-Nilsson L, et al. Highly specific monoclonal antibody demonstrates that pregnancy-specific glycoprotein (PSG) is limited to syncytiotrophoblast in human early and term placenta. Placenta. 1997;18:491–501
  16. Bocco JL, Panzetta G, Flury A, Patrito LC. Expression of pregnancy specific beta 1-glycoprotein gene in human placenta and hydatiform mole. Biochem Int. 1989;18:999–1008
  17. Aronow BJ, Richardson BD, Handwerger S. Microarray analysis of trophoblast differentiation: gene expression reprogramming in key gene function categories. Physiol Genomics. 2001;6:105–116
  18. Thompson J, Koumari R, Wagner K, Barnert S, Schleussner C, Schrewe H, et al. The human pregnancy-specific glycoprotein genes are tightly linked on the long arm of chromosome 19 and are coordinately expressed. Biochem Biophys Res Commun. 1990;167:848–859
  19. Panzetta-Dutari GM, Bocco JL, Reimund B, Flury A, Patrito LC. Nucleotide sequence of a pregnancy-specific beta 1 glycoprotein gene family member. Identification of a functional promoter region and several putative regulatory sequences. Mol Biol Rep. 1992;16:255–262
  20. Panzetta-Dutari GM, Koritschoner NP, Bocco JL, Nores R, Dumur CI, Patrito LC. Transcription of genes encoding pregnancy-specific glycoproteins is regulated by negative promoter-selective elements. Biochem J. 2000;350(2):511–519
  21. Koritschoner NP, Panzetta-Dutari GM, Bocco JL, Dumur CI, Flury A, Patrito LC. Analyses of cis-acting and trans-acting elements that are crucial to sustain pregnancy-specific glycoprotein gene expression in different cell types. Eur J Biochem. 1996;236:365–372
  22. Nores R, Blanchon L, Lopez-Diaz F, Bocco JL, Patrito LC, Sapin V, et al. Transcriptional control of the human pregnancy-specific glycoprotein 5 gene is dependent on two GT-boxes recognized by the ubiquitous specificity protein 1 (Sp1) transcription factor. Placenta. 2004;25:9–19
  23. Blanchon L, Nores R, Gallot D, Marceau G, Borel V, Yang VW, et al. Activation of the human pregnancy-specific glycoprotein PSG-5 promoter by KLF4 and Sp1. Biochem Biophys Res Commun. 2006;343:745–753
  24. Lopez-Diaz F, Nores R, Panzetta-Dutari G, Slavin D, Prieto C, Koritschoner NP, et al. RXRalpha regulates the pregnancy-specific glycoprotein 5 gene transcription through a functional retinoic acid responsive element. Placenta. 2007;28:898–906
  25. Angeletti S, Rena V, Nores R, Fretes R, Panzetta-Dutari GM, Genti-Raimondi S. Expression and localization of StarD7 in trophoblast cells. Placenta. 2008;29:396–404
  26. Kliman HJ, Nestler JE, Sermasi E, Sanger JM, Strauss JF. Purification, characterization, and in vitro differentiation of cytotrophoblasts from human term placentae. Endocrinology. 1986;118:1567–1582
  27. Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, et al. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 1997;25:3389–3402
  28. Leisser C, Saleh L, Haider S, Husslein H, Sonderegger S, Knofler M. Tumour necrosis factor-alpha impairs chorionic gonadotrophin beta-subunit expression and cell fusion of human villous cytotrophoblast. Mol Hum Reprod. 2006;12:601–609
  29. Bionaz M, Loor JJ. Gene networks driving bovine milk fat synthesis during the lactation cycle. BMC Genomics. 2008;9:366
  30. Morrish DW, Whitley GS, Cartwright JE, Graham CH, Caniggia I. In vitro models to study trophoblast function and dysfunction – a workshop report. Placenta. 2002;23(Suppl. A):S114–S118
  31. Karl PI, Harvey B, Fisher SE. Ethanol and mitotic inhibitors promote differentiation of trophoblastic cells. Alcohol Clin Exp Res. 1996;20:1269–1274
  32. Sharma VK, Kumar N, Brahmachari SK, Ramachandran S. Abundance of dinucleotide repeats and gene expression are inversely correlated: a role for gene function in addition to intron length. Physiol Genomics. 2007;31:96–103
  33. Chou JY, Zilberstein M. Expression of the pregnancy-specific beta 1-glycoprotein gene in cultured human trophoblasts. Endocrinology. 1990;127:2127–2135
  34. Huppertz B, Kadyrov M, Kingdom JC. Apoptosis and its role in the trophoblast. Am J Obstet Gynecol. 2006;195:29–39
  35. Wu JA, Johnson BL, Chen Y, Ha CT, Dveksler GS. Murine pregnancy-specific glycoprotein 23 induces the proangiogenic factors transforming-growth factor beta 1 and vascular endothelial growth factor A in cell types involved in vascular remodeling in pregnancy. Biol Reprod. 2008;79:1054–1061
  36. Tsoi SC, Cale JM, Bird IM, Kay HH. cDNA microarray analysis of gene expression profiles in human placenta: up-regulation of the transcript encoding muscle subunit of glycogen phosphorylase in preeclampsia. J Soc Gynecol Investig. 2003;10:496–502
  37. Vaiman D, Mondon F, Garces-Duran A, Mignot TM, Robert B, Rebourcet R, et al. Hypoxia-activated genes from early placenta are elevated in preeclampsia, but not in Intra-Uterine Growth Retardation. BMC Genomics. 2005;6:111
  38. Salahshor S, Goncalves J, Chetty R, Gallinger S, Woodgett JR. Differential gene expression profile reveals deregulation of pregnancy specific beta1 glycoprotein 9 early during colorectal carcinogenesis. BMC Cancer. 2005;5:66
  39. Yamamoto H, Flannery ML, Kupriyanov S, Pearce J, McKercher SR, Henkel GW, et al. Defective trophoblast function in mice with a targeted mutation of Ets2. Genes Dev. 1998;12:1315–1326
  40. Ghosh D, Ezashi T, Ostrowski MC, Roberts RM. A central role for Ets-2 in the transcriptional regulation and cyclic adenosine 5′-monophosphate responsiveness of the human chorionic gonadotropin-beta subunit gene. Mol Endocrinol. 2003;17:11–26
  41. Wendling O, Chambon P, Mark M. Retinoid X receptors are essential for early mouse development and placentogenesis. Proc Natl Acad Sci USA. 1999;96:547–551
  42. Tarrade A, Schoonjans K, Guibourdenche J, Bidart JM, Vidaud M, Auwerx J, et al. PPAR gamma/RXR alpha heterodimers are involved in human CG beta synthesis and human trophoblast differentiation. Endocrinology. 2001;142:4504–4514
  43. Guibourdenche J, Alsat E, Soncin F, Rochette-Egly C, Evain-Brion D. Retinoid receptors expression in human term placenta: involvement of RXR alpha in retinoid induced-hCG secretion. J Clin Endocrinol Metab. 1998;83:1384–1387
  44. Knofler M, Saleh L, Bauer S, Galos B, Rotheneder H, Husslein P, et al. Transcriptional regulation of the human chorionic gonadotropin beta gene during villous trophoblast differentiation. Endocrinology. 2004;145:1685–1694
  45. Cheng YH, Handwerger S. A placenta-specific enhancer of the human syncytin gene. Biol Reprod. 2005;73:500–509

PII: S0143-4004(10)00020-2

doi:10.1016/j.placenta.2010.01.004

Placenta
Volume 31, Issue 4 , Pages 312-319, April 2010

Article Tools

* Image Usage & Resolution