Placenta
Volume 31, Issue 4 , Pages 251-258, April 2010

Altered global gene expressions of human placentae subjected to assisted reproductive technology treatments

  • Y. Zhang

      Affiliations

    • Center of Clinical Reproductive Medicine, First Affiliated Hospital of Nanjing Medical University, 300 Guangzhou Road, Nanjing, Jiangsu 210029, China
    • Jiangsu Key Laboratory of Reproductive Medicine, Nanjing Medical University, Nanjing 210029, China
  • ,
  • Y. Cui

      Affiliations

    • Center of Clinical Reproductive Medicine, First Affiliated Hospital of Nanjing Medical University, 300 Guangzhou Road, Nanjing, Jiangsu 210029, China
  • ,
  • Z. Zhou

      Affiliations

    • Jiangsu Key Laboratory of Reproductive Medicine, Nanjing Medical University, Nanjing 210029, China
  • ,
  • J. Sha

      Affiliations

    • Jiangsu Key Laboratory of Reproductive Medicine, Nanjing Medical University, Nanjing 210029, China
  • ,
  • Y. Li

      Affiliations

    • Family Planning Research Institute, Nanjing, Jiangsu 210036, China
  • ,
  • J. Liu

      Affiliations

    • Center of Clinical Reproductive Medicine, First Affiliated Hospital of Nanjing Medical University, 300 Guangzhou Road, Nanjing, Jiangsu 210029, China
    • Jiangsu Key Laboratory of Reproductive Medicine, Nanjing Medical University, Nanjing 210029, China
    • Corresponding Author InformationCorresponding author at: Center of Clinical Reproductive Medicine, First Affiliated Hospital of Nanjing Medical University, 300 Guangzhou Road, Nanjing, Jiangsu 210029, China. Fax: +86 25 83674442.

Accepted 5 January 2010. published online 29 January 2010.

Article Outline

Abstract 

Background

Researchers are more and more concerning the safety of fetus or offspring derived from assisted reproductive technology (ART) treatment. As the placenta is a critical organ that sustains and protects the fetus, we hypothesize that altered global gene expression of the placenta subjected to ART manipulation may reflect changes associated with ART procedures and subsequently causal related to offspring health.

Methods

Three term placenta samples were obtained from patients undergone in vitro fertilization and embryo transfer due to oviductal factors only. Other three control placentae were from those underwent normal pregnancy. A GeneChip Affymetrix HG-U133 Plus 2.0 Array was utilized to analyze the genes. Using qRT-PCR we certified microarray data from 10 dysregulated genes. Five genes were localized precisely in the placenta as per immunohistochemistry.

Results

Twenty-six differentially expressed genes were identified in the ART-treated placentae: 17 up-regulated; 9 down-regulated. Eighteen of these were classified into six groups according to critical placental function: immune response; transmembrane transport; metabolism; oxidative stress; cell differentiation; and other functions. Genes involved in immune response, such as ERAP2 and STAT4, and those regulating cell differentiations, such as MUC1, were discerned to be differentially expressed. These gene products were expressed in the placental villus tissues, either in the cytoplasm or in the membrane of syncytiotrophoblastic cells.

Conclusion

To our knowledge, this is the first study in comparing differentially expressed genes in placentae from patients undergone ART treatment vs. those underwent normal pregnancy. Abnormal profiles of critical placental functioning genes, such as ERAP2, STAT4 and MUC1, may be valuable biomarkers to understand how the placenta affects fetal development and ART-derived offspring's health problems.

Keywords: Microarray, Assisted reproductive technology, Placenta, Immune response

 

Back to Article Outline

1. Introduction 

Assisted reproductive technology (ART) is defined as a series of treatments used to achieve pregnancy, in which both oocytes and sperm are handled in vitro, such as conventional in vitro fertilization (IVF) and intracytoplasmic sperm injection (ICSI) [1]. Early data suggested that ART was safe and infants conceived with ART would develop normally. However in the past decade, increasing amount of well-designed studies have been showing that ART pregnancies could produce detrimental perinatal outcomes, compared to those of non-assisted pregnancies including: preterm birth; congenital abnormality; low birth weight; perinatal morbidity; mortality; negative neurodevelopmental outcome; or even cancer [2]. Moreover, some evidence has been uncovered indicating a possible link between ART and epigenetic alterations causing DNA modifications and imprinting defects [3], [4], which suggests that a reverse effect originated in the early periimplantation period. Recently it has been indicated that outcomes of ART were associated with anomalies in sperm chromatin packaging [5]. In addition, using proteome comparisons, ART procedures were proved to have some influence on placentation, such as membrane transport, metabolism, nucleic acid processing, stress response and the cytoskeleton [6]. However, results from a population-based cohort study indicated that adverse outcomes associated with assisted fertilization could be attributed not to the reproductive technology itself, but rather to certain other factors that lead either to infertility or subfertility [7]. Thus, this issue becomes even more controversial.

Disturbances of placental development, including the reduced utero-placental blood flow, decreased oxygen supply in the uterus or abnormal maternal nutrient status can alter the biological characteristics of trophoblast cells and bring about changes in normal placental function. Under such circumstances, the placenta may adapt by altering its functional protein expression or changing epigenetic modification of placental gene expression in order to meet the requirement of fetal development. The individual may possibly be 'programmed' for increased risk of developing various endocrine diseases in later adult life [8]. It has been shown that in human intrauterine growth retardation (IUGR), some trophoblast nutrients and ion transporters were down-regulated, whereas fetal overgrowth has been associated with an up-regulation of transporters for amino acids and glucose in the placental barrier [9]. Animal studies have demonstrated that during pregnancy, maternally-administered synthetic glucocorticoids, which could cross the placenta and affect fetal hypothalamic-pituitary-adrenal (HPA) development, resulted in changes in HPA axis function that persisted throughout life [10]. Moreover, using the murine model, it has been shown that fetuses and placentae exposed to metabolic, antioxidant, pro-inflammatory or anti-inflammatory signals in the process of intrauterine development might change either their DNA methylation or chromatin modification or both. Such alterations could lead to increased atherosclerosis susceptibility in later adulthood [11]. Variations in ART procedures such as: gonadotropins for superovulation; medication taken for pregnancy sustenance; intracytoplasmic sperm injection; blastocyst culture; assisted hatching; or preimplantation genetic diagnosis could disturb placental development which is assumed might alter placentation and possibly cause the harmful outcome in offspring derived from ART treatment.

Herein, by using microarray analysis of gene expression profile, we compared global gene expression patterns of placentae from mothers in ART group with those from control group. The objective of this study is to discover the potential effects of ART treatment on the gene expression in placenta and to possible casual relationship between ART procedures and offspring health.

Back to Article Outline

2. Materials and methods 

2.1. Subjects and ethics 

From 2006 to 2009, samples were donated by women who had either undergone ART (standard IVF) treatment or normal pregnancies, all with singleton gestations and Cesarean delivery. Clinical data were collected by Jiangsu Province Hospital's Center of Clinical Reproductive Medicine (CCRM), and organized in a database. The inclusion criteria for ART subjects were as follows: maternal age between 20 and 35 years; singleton pregnancy; full-term delivery; child birth weight between 2500 and 4000 g; no pregnancy complications or birth defects; and an agreement made by couples that they would undergo IVF due to oviductal factors, such as oviductal obstruction or chronic pelvic inflammation. And the quality of each male sperm was normal. This critical criteria was aimed to protect our results from any ambiguity. The sample size 3 for microarrays as the minimal number needed for statistical variance was determined by the availability of samples in the CCRM specimen bank that met the study's diagnostic criteria. Each of the three placental specimens from ART group was matched to each of the three from control group by: parity; maternal age; number of gestational weeks; and infants’ sex. Both ART and control groups are same for following parameters: mean birth weight (p = 0.70); baby/placenta weight ratios (p = 0.34); dimensions of placentae (p = 0.60); or gross pathological features of placentae (Table 1). The clinical application of ART was licensed by the Ministry of Health of the People's Republic of China. All the subjects gave informed consent, and the research program was approved by the Ethical Committee of the First Affiliated Hospital of Nanjing Medical University.

Table 1. Clinical characteristics of microarray study sample (N = 6).
Control (N = 3)ART (N = 3)
Maternal age (years)28.6 ± 6.1133.0 ± 1.73
Nulliparous (N)33
Gestational weeks at delivery39.0 ± 1.539.2 ± 0.8
Mode of deliveryCesareanCesarean
Birth weight (g)3443.3 ± 245.83350.0 ± 150.0
Infant sex
Female22
Male11
Placenta/baby weight6.50 ± 0.465.83 ± 0.46
CasesAge (years)GravidityParityGestational weeks at deliveryMode of deliverySex of the babyBirth weight (g)Length of placenta (cm)Width of placenta (cm)Height of placenta (cm)Weight of placenta (g)Baby/placenta weightCause of infertilityProcedure of ART
ART 1343039.3CesareanFemale3500161535007.00oviductalIVF-ET
ART 2343038.9CesareanMale3350181825506.09oviductalIVF-ET
ART 3311038.3CesareanFemale3200221935006.40oviductalIVF-ET
Cont 1341037.6CesareanFemale3360201836305.30
Cont 2305038.9CesareanFemale3250201835206.25
Cont 3221040.6CesareanMale3720201736305.09

2.2. Term placentae 

Each placenta was collected immediately following delivery. Fragments from the placental subchorial zone corresponding to umbilical cord insertion were dissected and areas of infarcted focus and hematomas were avoided. The placenta was then cut longitudinally form the maternal side to fetal side,. As per a previous report from Sood et al., the placenta tissue was divided into three parts, each with a different gene profile: maternal; middle; and fetal [12]. Therefore, the villi of the middle section were collected in the present study to minimize the contamination of gene expression from maternal or fetus. All placental parts were then floated in ice-cold PBS, and finally stored in liquid nitrogen until future total RNA extraction.

2.3. RNA extraction 

Tissue homogenization and RNA extraction, together with later microarray was performed at CapitalBio Corporation, Bejing, China. Homogenization of the tissue and isolation of the total RNA were performed according to the manufacturer's instructions using the Macherey–Nagel NucleoSpin RNA II kit (Macherey–Nagel, Düren, Germany). This RNA isolation kit significantly reduces contamination of both genome DNA and proteins. The RNA, extracted with ribosomal 28S and 18S RNA with a ratio of intensities of 1.0–1.5:1, was used in both the later microarray assay and qRT-PCR.

2.4. Microarray analysis 

In order to compare the differentially expressed genes in the two groups, an aliquot (2 ug) of the total placental RNA was used to synthesize double-stranded cDNA, which was subsequently transcribed into biotin-tagged cRNA using the MessageAmp II aRNA Amplification Kit (Ambion, Austin, TX). The cRNA was then fragmented to produce strands of 35–200 bases in length in accordance with protocols (Affymetrix, Santa Clara, CA). The fragmented cRNA was hybridized to the Affymetrix GeneChip Human Genome U133 Plus 2.0 Array, containing 47 000 transcripts. Microarray hybridization was performed at 45 °C with rotation lasting for 16 h using an Affymetrix GeneChip Hybridization Oven 640. The arrays were washed and stained (streptavidin-phycoerythrin) at an Affymetrix GeneChip Fluidics Station 450, then later scanned on an Affymetrix GeneChip Scanner 3000 to analyze the hybridization data. The scanned images obtained were assessed firstly by visual inspection and then were analyzed utilizing Affymetrix GeneChip Operating Software (GCOS 1.4). To normalize the different arrays dChip software was used in a global scaling procedure. In a comparison analysis, a two-class, unpaired method from the Significance Analysis of Microarrays (SAM version 3.02, Stanford University, Stanford, CA) software was used to compare significantly differentially expressed genes in both the ART and non-ART groups (Table 2).

Table 2. Genes differentially expressed in placentae derived from ART treatment.
Probe Set IDGene symbolGene nameGeneBankaGo OntologybCell componentFold change
219759_atERAP2Endoplasmic reticulum aminopeptidase 2NM_001130140///NM_022350Zinc ion binding///metallopeptidase activity///N-terminal arginine aminopeptidase activity///blood pressure regulation///N-terminal lysine aminopeptidase activity///endoplasmic reticulum lumen antigen processing and presentation of endogenous peptide antigen via MHC class I proteolysis///membrane alanyl aminopeptidase activity///aminopeptidase activityEndoplasmic reticulum membrane6.00
222068_s_atLRRC50Leucine rich repeat containing 50NM_178452_Cell projection///cilium5.01
39248_atAQP3Aquaporin 3NM_004925Excretion///transporter activity///membrane fraction///integral to plasma membrane///transport///membraneBasolateral cell membrane4.38
210662_atKYNUKynureninase (l-kynurenine hydrolase)NM_001032998///NM_003937_Secreted3.41
205319_atPSCAProstate stem cell antigenNM_005672Plasma membranePlasma membrane2.89
211751_atPDE4DIPPhosphodiesterase 4D interacting proteinNM_001002810///NM_001002811///NM_001002812///NM_014644///NM_022359_Golgi apparatus///centrosome2.55
224580_atSLC38A1Solute carrier family 38, member 1NM_001077484///NM_030674Amino acid transportPlasma membrane2.26
206023_atNMUNeuromedin UNM_006681Receptor binding///signal transduction///neuropeptide signaling pathway///digestion///regulation of smooth muscle contractionSecreted2.24
235592_at_____2.23
233115_at_____2.23
214598_atCLDN8Claudin 8NM_199328Tight junction///calcium-independent cell–cell adhesion///identical protein binding///membrane///structural molecule activity///integral to membraneCell junction///tight junction2.22
204142_atENOSF1Enolase superfamily member 1NM_001126123///NM_017512Metabolism///catalytic activityMitochondrial2.19
238623_at_____2.18
212329_atSCAPSREBF chaperoneNM_012235Cholesterol metabolism///endoplasmic reticulum///lipid metabolism///Golgi stack///unfolded protein binding///sterol depletion response, SREBP target gene transcriptional activation///positive regulation of low-density lipoprotein receptor biosynthesis///negative regulation of cholesterol biosynthesis///membrane///steroid metabolism integral to membraneCytoplasmic vesicle///endoplasmic reticulum///Golgi apparatus///membrane2.16
213234_atKIAA1467KIAA1467NM_020853_Endoplasmic reticulum///membrane2.12
220528_atVNN3Vanin 3NM_001024460///NM_018399///NM_078625Pantetheinase activity///nitrogen compound metabolism///membraneCell membrane2.01
209990_s_atGABBR2Gamma-aminobutyric acid (GABA) B receptor, 2NM_005458Postsynaptic membrane///synaptic transmission///integral to plasma membrane///signal transduction///receptor activity///GABA-B receptor activity///negative regulation of adenylate cyclase activity///G-protein coupled receptor protein signaling pathwayCell junction///cell membrane///membrane///postsynaptic cell membrane///synapse2.00
224559_atMALAT1Metastasis-associated lung adenocarcinoma transcript 1 (non-protein coding)NR_002819__−2.03
239006_atSLC26A7Solute carrier family 26, member 7NM_052832///NM_134266Anion exchanger activity///chloride channel activity///oxalate transmenbrane transporter activity///sulfate transmenbrane transporter activityBasolateral plasma membrane///integral to membrane///recycling endosome membrane−2.08
206118_atSTAT4Signal transducer and activator of transcription 4NM_003151JAK-STAT cascade///regulation of transcription from RNA polymerase II promoter///nucleus///calcium ion binding///intracellular signaling cascade///signal transducer activity///transcription factor activity///transcription"Cytoplasm///nucleus−2.15
226838_atLOC130502Tetratricopeptide repeat domain 32NM_001008237Binding_−2.28
207010_atGABRB1Gamma-aminobutyric acid (GABA) A receptor, beta 1NM_000812Ion channel activity///neurotransmitter receptor activity///ion transport///postsynaptic membrane///integral to plasma membrane///signal transduction///extracellular ligand-gated ion channel activity///GABA-A receptor activityCell junction///cell membrane///membrane///postsynaptic cell membrane///synapse−2.29
236439_at_____−2.36
226622_atMUC20Mucin 20, cell surface-associatedNM_001098516///NM_152673///XM_001726694Protein homooligomerization///basal plasma membraneCell membrane///cell projection///membrane///secreted−2.43
205984_atCRHBPCorticotropin: releasing hormone; binding proteinNM_001882Soluble fraction///signal transduction///protein binding///pregnancy///earning and/or memorySoluble fraction−2.47
213693_s_atMUC1Mucin 1, cell surface-associatedNM_001018016///NM_001018017///NM_001044390///NM_001044391///NM_001044392///NM_001044393///NM_002456Integral to membraneApical cell membrane−2.73

ahttp://www.ncbi.nlm.nih.gov/Genbank/.

bhttp://www.geneontology.org/.

2.5. qRT-PCR 

qRT-PCR was conducted on 10 genes differentially expressed in the microarray, whose functions were considered to be closely related to some critical placental functions after the biological function analysis. We used the same RNAs extracted from those placental samples. The first-strand complementary synthesis reaction was performed using the PrimeScript RT reagent Kit (Perfect Real Time) (TaKaRa Biotechnology [Dalian] Co., Ltd., Dalian, China). Amplification reactions were conducted using SYBR Premix Ex Taq (Perfect Real Time) (TaKaRa Biotechnology [Dalian] Co., Ltd.,) with an ABI PRISM 7300 system. Gene-specific qRT-PCR primers were used as listed in Table 3. GAPDH was served as an internal control to normalize the loading of template cDNA. Each set of qRT-PCR was repeated twice, and the fold change in expression of each gene of interest was analyzed via the DDCt method [13]. Student's t-test of independent data was used in statistical analysis.

Table 3. Sequences of primers used for qRT-PCR.
Gene symbol Sequence (5′ −3′)Amplicon size
ERAP2FGACCCCAAGACCTCTTCTGCTTC256bp
RAGATAGGGCGGGATGAATTCAAT
VNN3FGACTTCTCCCTCAGTGGCACATT121bp
RGGCTCCTCAAGCGTCCATCTC
NMUFGATTATGGGAATGCTACCAAAGC135bp
RTGCAGCAACGGATGCACAA
CLDN8FGATTCCCTGCTGGCTCTTTCTC151bp
RTGTGAGCCTTCACCTTCTCATTGT
SCAPFAAGTTCTACTCCATTCAGCAGGACC251bp
RAGCACAGAGGGCACATACACCA
GABRB1FGCCGACTAAGTTGCATTCCTTGA160bp
RTGCTGGGTTCATTGGTGCTGT
CRHBPFGTTCCACACCAGCATCGAAACT135bp
RGTCTCCTATTCCCTCGCAACCT
MUC1FTCAGTGCCGCCGAAAGAACT194bp
RCCACTGCTGGGTTTGTGTAAGAGA
SLC26A7FAGCTTCACAGTCCTGCCCTAATG127bp
RCACACTCCTGCCTTTACAGTCCAT,
STAT4FCAACAGAGCCACATTCTCCATCAG158bp
RGCTTCCTTTCTTGGTGCGTCAG
GAPDHFGAAGGTCGGAGTCAACGGATTT223bp
RCTGGAAGATGGTGATGGGATTTC

2.6. Immunohistochemistry 

In order to have a better understanding of the functions of these certified differentially expressed genes in ART group, immunohistochemistry (IHC) was performed to analyze the gene products ERAP2, STAT4, MUC1, SCAP and VNN3. Primary antibodies utilized are as follows: ERAP2 (1:100 dilution, Abcam, Cambridge, MA); STAT4 (1:125 dilution, Abcam); MUC1 (1:100 dilution, Sigma–Aldrich, St. Louis, MO); SCAP (1:5 dilution, Sigma–Aldrich); and VNN3 (1:25 dilution, Sigma–Aldrich). Formalin-fixed, paraffin-embedded placental tissues from control group were deparaffinized, re-hydrated, sectioned (4 um) and immunostained. The detection of these proteins in the placental tissues was carried out by a two-step IHC procedure [6]. Immunohistochemical staining of samples and negative controls was simultaneously executed.

Back to Article Outline

3. Results 

3.1. Microarray data 

After SAM analysis of microarray data, 26 genes were certified to be significantly differentially expressed between the groups, with a threshold fold change over 2.0 and an absolute value score of 1.6. The list of 26 differentially expressed genes was used for unsupervised hierarchical clustering, and the results (Fig. 1A) were analyzed and visualized by the TreeView program.

  • View full-size image.
  • Fig. 1 

    Clustering display of microarray data and the functional classification of differentially expressed genes in placenta. (A) The comparison of the 26 differentially expressed genes between the ART and control groups were performed using SAM software, then upon hierarchical clustering, visualized with TreeView tools. Gene symbols are labeled on the right. Expression levels are represented by a color tag, with red representing the highest levels of expression, and green for the lowest. (B, C) The two classifications according to functions and cell components of differentially expressed genes of interest in this study, found in normal and ART-manipulated placentae. The 18 identified genes are divided into six groups according to their biological functions (B) and six groups according to their cell components (C). The percentage of genes in each group is also indicated.

The Affymetrix probe identification numbers were submitted to the NetAffx Analysis Center. Annotations for gene names and Gene Ontology (GO) molecular functions for the differentially expressed 26 genes were then obtained (Table 2). Seventeen genes were up-regulated and 9 were down-regulated. Among these, 8 genes of unknown function: 4 mapped; and 4 unmapped, were excluded from our functional analysis. The remaining 18 differentially expressed genes were classified according to their biological processes into six groups (Fig. 1B): immune response; transmembrane transport; metabolism; oxidative stress; cell differentiation; and other processes. Most above biological processes are closely associated with critical placental functions. Also, data of these same genes were then categorized into another six groups according to identity (Fig. 1C): organelle, cell membrane, secreted, cell junction, nucleus, and a body or collection of unknown components.

3.2. Confirmation with qRT-PCR 

Based on their biological processes most closely related to placental functions, 10 differential genes were selected out of the previous 18 to confirm their expression differences (Fig. 2). The qRT-PCR data confirmed the up-regulation of ERAP2, VNN3, CLDN8 and SCAP, and the down-regulation of GABRB1, MUC1, SLC26A7, and STAT4 in placentae that had undergone ART treatment, and compared the genes with those placentae undergoing normal pregnancy. These were in line with the microarray data set. Comparison of the expressions of the other two selected genes, NMU and CRHBP, between the two groups did not differ significantly, although their tendency of change was consistent with the rest of the microarray data. That the microarray data was validated by qRT-PCR with an efficiency of 80% suggests the reasonable certainty of the fold change observed by microarray analysis.

  • View full-size image.
  • Fig. 2 

    The results of qRT-PCR for differentially expressed genes from placental tissue derived from ART manipulation. ERAP2, VNN3, NMU, CLDN8, SCAP, GABRB1, CRHBP, MUC1, SLC26A7 and STAT4 mRNA abundance were quantified by qRT-PCR to validate the microarray results. Comparisons were drawn between the control (open bars) and ART-manipulated group (black bars). All data were presented as the mean ± SD. Significant differences are indicated (*P < 0.05, **P < 0.01).

3.3. Detection by immunohistochemistry 

To locate differentially expressed gene products in the human placenta, 5 genes representing different critical placental functions were selected for IHC analysis: ERAP2 and STAT4, closely related to immune response; MUC1, which has been linked to cell differentiation; SCAP, associated with the metabolism process; and VNN3, involved in oxidative stress (Fig. 3). These five proteins were found to be located in either the cytoplasm or membrane of syncytiotrophoblastic cells of placental villous tissues.

  • View full-size image.
  • Fig. 3 

    Immunohistochemistry on ERAP2, STAT4, MUC1, SCAP and VNN3 for the detection of cellular localizaton. All proteins were found located in either the cytoplasm or membrane of syncytiotrophoblastic cells in placental villus tissues obtained from control group. Negative control sections shown in the bottom row were incubated with non-mmunized normal corresponding IgG. (Scale Bar = 10 um).

Back to Article Outline

4. Discussion 

It is widely agreed that ART has been extensively used in clinical practice without any comprehensive evaluation of its effects on the health of children so conceived. The underlying mechanisms of these increased health defects need to be elucidated. In the present study, whole genome microarray analyses were utilized. This was the first time that a human placenta undergoing ART treatment had had its global gene expression analyzed. The 18 genes identified as differentially expressed fall into six categories according to the following functions: immune response; transmembrane transport; metabolism; oxidative stress; cell differentiation; and other functions.

During pregnancy the mother's immunological tolerance to the fetus is essential for both maternal and fetal survival. Any stress or infection during the period of pregnancy would impair immune responses, resulting in fetal destruction and/or maternal death. In this study, the three genes ERAP2, KYNU and STAT4, all of which are involved in immune response, were found to be differentiatally expressed in ART-treated placentae. ERAP2, located in the endoplasmatic reticulum (ER), is a member of the oxytocinase subfamily [14] which plays an important role in regulating the ER's antigen processing. It has been postulated that low or deregulated expression of ERAP2 could lead to impaired antigen processing, thus favoring the escape of tumor cells from immune surveillance [15]. Recently, the ERAP2 gene was found to be associated with preeclampsia in Australian and Norwegian populations [16], although the underlying mechanism is still unclear.

STAT4, belonging to the Signal Transducers and Activator of Transcription (STAT) protein family of transcription factors, is thought to be essential for regulating the differentiation of T helper cells and maintaining adaptive immune responses. STAT4 also has been identified as a genetic risk factor for rheumatoid arthritis (RA) and type 1 diabetes [17]. The differential expression of these genes indicated that improper antigen processing and enhanced immune surveillance was occurring in the maternal-fetal interface of the ART-treated placentae. This imbalance could possibly result in several immune-related pregnancy complications, such as preesclapmsia or premature delivery, both commonly seen in women who have undergone any ART treatment.

Transmembrane transport is involved in a wide variety of vital placental functions including: transferring nutrients and waste products between mother and fetus; maintaining a maternal-fetal immunological tolerance interface; and producing many peptide and steroid hormones for both maternal and fetal circulation. Disturbances and imbalances of syncytiotrophoblast transmembrane transport function seem to be directly associated with pathological clinical conditions. In this study, 3 genes involved in placental transmembrane transport were identified: AQP3 up-regulated, while SLC26A7 and CLDN8 down-regulated.

AQP3 is a member of the aquaporin family, a water channel protein that facilitates fluid movement across cell membranes. AQP3, which facilitates water transport across the placental trophoblast barrier, has been detected in the apical membranes of syncytiotrophoblasts [18]. Compared with AQP3 expression in the human placentae in one group with normal amniotic fluid, that in a second group experiencing oligohydramnios (AF) was shown to be significantly increased [19], suggesting that AQP3 expression may be important to sustain AF homeostasis. Moreover, AQP3 has been proved to be involved in the pathophysiology of gestational diabetes mellitus (GDM) [20] possibly due to its participation in the control of blood glucose levels. In our current study, AQP3 was found to be highly expressed in placentae that had undergone ART manipulation, which might partly explain why ART procedures accompany many pregnancy complications, such as abnormal AF homeostasis, preeclampsia or GDM.

Belonging to a family of Cl-/HCO3- exchangers, SLC26A7 has been reported to express both on the basolateral membrane and in the cytoplasm of some acid-secreting epithelial cells, mediating traffic between cell membranes and intracellular compartments in order to maintain intracellular homeostasis [21]. SLC26A7 has also proved to play an important role in maintaining both the intracellular pH of the syncytiotrophoblasts and fetal pH homeostasis [22].

CLDN8 is a membrane of the claudin family, a family composed of integral membrane proteins acting as the barrier of tight junctions that is thought to participate in the permeation of solutes across epithelia via the paracellular pathway. The claudin family serves also as a novel target for the system of drug delivery [23]. Tight junctions do exist in the syncytiocytotrophoblasts of early placental development, as well as the fetal arterioles and capillaries of term placentae [24]. Diminished expression of tight junction proteins of term placentae was observed during preeclampsia [25]. However it is still unclear if the up-regulated CLDN8 causes any alteration of the placental barrier's tight junction, which would further cause abnormality in trans-placental transport.

Amino acid metabolism in the placental tissue is essential for fetal growth, as amino acids are important not only for the accretion of fetal proteins, but also could serve as both energy metabolites and biosynthetic precursors for various metabolic pathways. In our study, a critical amino acid transporter was discovered. Belonging to amino acid transport System A, SLC38A1 is located in both the microvillus membrane (MVM) and basal membrane of the syncytiotrophoblast, and is the major amino acid transporter of the human placenta. SLC38A1 is regulated both by hypoxia and endocrine signals from either the mother or fetus. It has been reported that decreased System A activity in the MVM of the human placenta was associated with IUGR [26]. In our study, SLC38A1 was up-regulated in placentae that underwent ART treatment, possibly due to the following causes: placental compensatory response to the high quality diet provided to the pregnant women; the hormone used during ovarian stimulation cycles; or any other interventions performed during any part of the pregnancy in order to sustain the fetal growth rate. Such up-regulation of SLC38A1 could map the fetus in such a way as to have a detrimental effect on the individual's later life.

When oxidative stress occurs in the human placenta, reactive oxygen species including nitric oxide, carbon monoxide and superoxide, have been shown to participate in a number of operations such as trophoblast invasion and the regulation of placental vascular reactivity, in addition to others. The imbalance that oxidative stress brings on could result in either early and/or mid-trimester pregnancy loss, preeclampsia or IUGR. Interestingly in this present study, VNN3, involved in oxidative stress, was highly expressed in placentae that underwent ART manipulation. VNN3, belonging to the vanin family, is a secreted ectoenzyme engaged in pantetheinase activity, which may play a role in both the oxidative stress response [27] and detoxification [28]. In animal models, the up-regulation of VNN3 in placentae that underwent ART treatment suggested that oxidative stress would increase under such manipulation, with the placentae would mount multiple defense systems to sustain normal fetal growth.

During placental development, cytotrophoblasts in the placental villi differentiate into either extravillus trophoblasts or syncytiotrophoblasts. Their well-controlled differentiation and maintenance are essential for normal placental functioning to ensure successful pregnancies and healthy births. Prostate Stem Cell Antigen (PSCA), highly expressed in many other kinds of cancers, is thought to be a molecular marker of abnormal cell proliferation and differentiation [29]. It has been reported that the overexpression of PSCA was associated with the development of gestational trophoblastic neoplasia in hydatidiform moles. Such a high level of PSCA has also been found in choriocarcinomas and placental site trophoblastic tumors [30].

MUC1 is a member of the mucin family and was postulated to be involved in cell proliferation, apoptosis, adhesion and invasion[31]. The expression of MUC1 has been detected in the human placenta throughout pregnancy, mainly in syncytiotrophoblasts [32], and was proved to be involved in both trophoblast adhesion to uterine endothelial cells, and in trophoblast transendothelial migration through either its anti-adhesive or adhesive activities [33]. Overexpression of MUC1 was proved to suppress trophoblast-like cell invasion in vitro [34]. The up-regulation of PSCA and the down-regulation of MUC1 indicated that ART manipulations either altered the trophoblasts' adhesion and anti-adhesion, or their cell motility, thus affecting cytotrophoblast cell differentiation.

To the best of our knowledge, this is the first known study comparing global gene expression in term placental tissues after ART procedures to that in term placental tissues of normal pregnancy. The microarray data results were certified by qRT-PCR and IHC, to arise from both mRNA abundance and protein localization. The 26 differentially expressed genes provided both potential biomarkers of ART manipulations and promising clues to ART etiology, including: altered immune response in maternal-fetal interface; dysregulation of maternal-fetal transmembrane transport; changed status of both amino acid and cholesterol metabolism; and alteration in both trophoblast proliferation and the differentiation bioprocesses. Our results elucidate the possible linkage between ART manipulations and fetal programming. It follows that one might predict the potentially best and worst outcomes of infants' future lives as adults. Clearly, more work is needed to understand the roles of the differentially expressed genes in ART-treated placentae as well as investigate whether ART manipulations have some effects on placentation.

Back to Article Outline

Conflict of interest 

The authors declare no conflicts of interest.

Back to Article Outline

Acknowledgements 

We gratefully acknowledge the CapitalBio Corporation for conducting the RNA extractions and microarrays. This work was supported by the National 973 Program of China (2006CB944005; and 2007CB948103); and the Jiangsu Province Science & Technology Program (BM2008151).

Back to Article Outline

References 

  1. Reefhuis J, Honein MA, Schieve LA, Correa A, Hobbs CA, Rasmussen SA. Assisted reproductive technology and major structural birth defects in the United States. Hum Reprod. 2009;24(2):360–366
  2. Steel AJ, Sutcliffe A. Long-term health implications for children conceived by IVF/ICSI. Hum Fertil Camb. 2009;12(1):21–27
  3. Wilkins-Haug L. Assisted reproductive technology, congenital malformations, and epigenetic disease. Clin Obstet Gynecol. 2008;51(1):96–105
  4. Neelanjana M, Sabaratnam A. Malignant conditions in children born after assisted reproductive technology. Obstet Gynecol Surv. 2008;63(10):669–676
  5. Tarozzi N, Nadalini M, Stronati A, Bizzaro D, Dal Prato L, Coticchio G, et al. Anomalies in sperm chromatin packaging: implications for assisted reproduction techniques. Reprod Biomed Online. 2009;18(4):486–495
  6. Zhang Y, Zhang YL, Feng C, Wu YT, Liu AX, Sheng JZ, et al. Comparative proteomic analysis of human placenta derived from assisted reproductive technology. Proteomics. 2008;8(20):4344–4356
  7. Romundstad LB, Romundstad PR, Sunde A, von During V, Skjaerven R, Gunnell D, et al. Effects of technology or maternal factors on perinatal outcome after assisted fertilisation: a population-based cohort study. Lancet. 2008;372(9640):737–743
  8. Barker DJ. Intrauterine programming of adult disease. Mol Med Today. 1995;1(9):418–423
  9. Jansson T, Myatt L, Powell TL. The role of trophoblast nutrient and ion transporters in the development of pregnancy complications and adult disease. Curr Vasc Pharmacol. 2009;
  10. Kapoor A, Petropoulos S, Matthews SG. Fetal programming of hypothalamic-pituitary-adrenal (HPA) axis function and behavior by synthetic glucocorticoids. Brain Res Rev. 2008;57(2):586–595
  11. Alkemade FE, Gittenberger-de Groot AC, Schiel AE, VanMunsteren JC, Hogers B, van Vliet LS, et al. Intrauterine exposure to maternal atherosclerotic risk factors increases the susceptibility to atherosclerosis in adult life. Arterioscler Thromb Vasc Biol. 2007;27(10):2228–2235
  12. Sood R, Zehnder JL, Druzin ML, Brown PO. Gene expression patterns in human placenta. Proc Natl Acad Sci U S A. 2006;103(14):5478–5483
  13. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25(4):402–408
  14. Tanioka T, Hattori A, Masuda S, Nomura Y, Nakayama H, Mizutani S, et al. Human leukocyte-derived arginine aminopeptidase. The third member of the oxytocinase subfamily of aminopeptidases. J Biol Chem. 2003;278(34):32275–32283
  15. Fruci D, Ferracuti S, Limongi MZ, Cunsolo V, Giorda E, Fraioli R, et al. Expression of endoplasmic reticulum aminopeptidases in EBV-B cell lines from healthy donors and in leukemia/lymphoma, carcinoma, and melanoma cell lines. J Immunol. 2006;176(8):4869–4879
  16. Johnson MP, Roten LT, Dyer TD, East CE, Forsmo S, Blangero J, et al. The ERAP2 gene is associated with preeclampsia in Australian and Norwegian populations. Hum Genet. 2009;
  17. Remmers EF, Plenge RM, Lee AT, Graham RR, Hom G, Behrens TW, et al. STAT4 and the risk of rheumatoid arthritis and systemic lupus erythematosus. N Engl J Med. 2007;357(10):977–986
  18. Damiano A, Zotta E, Goldstein J, Reisin I, Ibarra C. Water channel proteins AQP3 and AQP9 are present in syncytiotrophoblast of human term placenta. Placenta. 2001;22(8–9):776–781
  19. Zhu XQ, Jiang SS, Zhu XJ, Zou SW, Wang YH, Hu YC. Expression of aquaporin 1 and aquaporin 3 in fetal membranes and placenta in human term pregnancies with oligohydramnios. Placenta. 2009;30(8):670–676
  20. Enquobahrie DA, Williams MA, Qiu C, Meller M, Sorensen TK. Global placental gene expression in gestational diabetes mellitus. Am J Obstet Gynecol. 2009;200(2)(206):e1–13
  21. Xu J, Worrell RT, Li HC, Barone SL, Petrovic S, Amlal H, et al. Chloride/bicarbonate exchanger SLC26A7 is localized in endosomes in medullary collecting duct cells and is targeted to the basolateral membrane in hypertonicity and potassium depletion. J Am Soc Nephrol. 2006;17(4):956–967
  22. Cowley EA, Sellers MC, Illsley NP. Intracellular pH homeostasis in cultured human placental syncytiotrophoblast cells: recovery from acidification. Am J Physiol Cell Physiol. 2005;288(4):C891–C898
  23. Kondoh M. Claudin as a novel target for drug delivery system. Yakugaku Zasshi. 2006;126(9):711–721
  24. Challier JC, Dubernard G, Galtier M, Bintein T, Vervelle C, Raison D, et al. Junctions and adhesion molecules in first trimester and term human placentas. 51. Noisy-le-grand: Cell Mol Biol; 2005;Suppl:OL713-22
  25. Lievano S, Alarcon L, Chavez-Munguia B, Gonzalez-Mariscal L. Endothelia of term human placentae display diminished expression of tight junction proteins during preeclampsia. Cell Tissue Res. 2006;324(3):433–448
  26. Jansson T, Ylven K, Wennergren M, Powell TL. Glucose transport and system A activity in syncytiotrophoblast microvillous and basal plasma membranes in intrauterine growth restriction. Placenta. 2002;23(5):392–399
  27. Martin F, Malergue F, Pitari G, Philippe JM, Philips S, Chabret C, et al. Vanin genes are clustered (human 6q22–24 and mouse 10A2B1) and encode isoforms of pantetheinase ectoenzymes. Immunogenetics. 2001;53(4):296–306
  28. Kimura T, Oguro I, Kohroki J, Takehara M, Itoh N, Nakanishi T, et al. Metallothionein-null mice express altered genes during development. Biochem Biophys Res Commun. 2000;270(2):458–461
  29. Raff AB, Gray A, Kast WM. Prostate stem cell antigen: a prospective therapeutic and diagnostic target. Cancer Lett. 2009;277(2):126–132
  30. Feng HC, Tsao SW, Ngan HY, Xue WC, Kwan HS, Siu MK, et al. Overexpression of prostate stem cell antigen is associated with gestational trophoblastic neoplasia. Histopathology. 2008;52(2):167–174
  31. Singh PK, Hollingsworth MA. Cell surface-associated mucins in signal transduction. Trends Cell Biol. 2006;16(9):467–476
  32. Paszkiewicz-Gadek A, Porowska H, Sredzinska K. Expression of MUC1 mucin in full-term pregnancy human placenta. Adv Med Sci. 2008;53(1):54–58
  33. Thirkill TL, Cao T, Stout M, Blankenship TN, Barakat A, Douglas GC. MUC1 is involved in trophoblast transendothelial migration. Biochim Biophys Acta. 2007;1773(6):1007–1014
  34. Shyu MK, Lin MC, Liu CH, Fu YR, Shih JC, Lee CN, et al. MUC1 expression is increased during human placental development and suppresses trophoblast-like cell invasion in vitro. Biol Reprod. 2008;79(2):233–239

PII: S0143-4004(10)00021-4

doi:10.1016/j.placenta.2010.01.005

Placenta
Volume 31, Issue 4 , Pages 251-258, April 2010