Orphan Receptor Kinase ROR2 is Expressed in the Mouse Uterus
Article Outline
- Abstract
- 1. Introduction
- 2. Materials and methods
- 3. Results
- 4. Discussion
- Conflict of interests
- Acknowledgments
- References
- Copyright
Abstract
Objective
Wingless-type mouse mammary tumor virus integration site family, member 5A (WNT5A), is expressed in mouse decidua and is thought to play an important role in decidualization. We examined expression of the receptor for WNT5A, receptor tyrosine kinase-like orphan receptor 2 (ROR2), in the uteri of cycling and pregnant mice.
Study design
Reverse transcription (RT)-PCR and immunohistochemistry were performed.
Results
RT-PCR revealed that transcripts for Ror2, Wnt3a, Wnt5a and inhibitor of WNT signaling, Dickkopf homolog 1 (Dkk1), were present in the pregnant uterus. Immunohistochemistry revealed that in the virgin uterus, ROR2 is expressed in stromal cells and on the basal side of uterine gland and endometrial epithelial cells. During pregnancy, both the luminal and basal side of uterine gland epithelial cells expressed ROR2, stromal cell expression of ROR2 became more frequent and ROR2 expressing uterine Natural Killer (NK) cells and cells lining the maternal vascular space emerged. Immunofluorescence imaging and flow cytometry revealed that although uterine NK cells expressed ROR2, NK cells of the spleen were ROR2 negative.
Conclusion
The expression of ROR2 by endometrial epithelial cells may suggest WNT signaling has roles in uterine epithelial cell polarity or implantation. Expression of ROR2 by uterine NK cells may suggest WNT signaling regulates uterine NK cell functions such angiogenesis and regulation of trophoblast migration. In summary, our results show that ROR2 expression by maternal uterine cells is influenced by pregnancy.
Keywords: Decidua, Estrous cycle, Receptor tyrosine kinase-like orphan receptor 2, Uterine natural killer cell, WNT signaling
1. Introduction
Receptor tyrosine kinase-like orphan receptor 2 (ROR2) is a type 1 transmembrane protein expressed during embryonic development. Important in chondrocyte formation, ROR2 plays a role in cartilage and growth plate development [1]. Individuals with mutations in ROR2 display brachydactyly B (aplasia/hypoplasia of phalanges) [2] and Robinow syndrome [3], a syndrome characterized by a malformation of the limbs, face, head and genitalia [4]. ROR2 interacts with melanoma antigen family D, 1 (MAGED1) [5], wingless-type mouse mammary tumor virus integration site family, member 5A (WNT5A) [6] and frizzled homolog 2 (FZD2) [7]. Initially, it was reported that ROR2 participates in Wingless (WNT) signaling through the non-canonical beta-catenin (CTNNB1) independent pathway [8]; however, recent work has shown that ROR2 is also capable of canonical (CTNNB1 dependant) signaling [7].
Most of the literature concerning ROR2 addresses its interactions with WNT5A that occur during development. Recently however, ROR2 functions in other contexts have been described, such as its role in gut epithelial cell regeneration. In murine small intestine, ROR2 has been localized to epithelial cells with expression along the crypt-villus axis [9]. In vitro studies demonstrated that activation of the extracellular calcium-sensing receptor (CaSR) on subepithelial myofibroblasts stimulated the synthesis and secretion of WNT5A [9]. A paracrine interaction was then revealed between myofibroblast WNT5A and epithelial ROR2, by showing that WNT5A stimulation of ROR2 increased the caudal homeodomain factor CDX2 protein expression and stimulation of sucrase–isomaltase promoter activity. WNT5A has also been shown to stimulate ROR2 on adenomatous polyposis coli (APC)-truncated colon cancer cells to inhibit defective CTNNB1 signaling by increasing E-type ubiquitin ligases [10]. This suggests in the normal adult intestine ROR2 can signal non-canonically.
ROR2 signaling appears dependent on the cell type and tissue it is expressed in (Li et al., 2008). Cell proliferation occurs in many adult tissues; however, the process of decidualization, the expansion of endometrial stromal cells in the uterus under the influences of progesterone and other signals, is one of the most critical because it is essential for blastocyst implantation and pregnancy in primates and rodents [11]. In humans, decidualization is initiated during the late secretory phase of the menstrual cycle to create a lush uterine wall receptive for implantation of the embryo [12], [13], [14]. If implantation occurs, decidualization continues. If implantation does not occur, the decidualizing uterine endometrium regresses and is shed as menstrual fluid. In rodents, primary decidualization is initiated anti-mesometrially in response to blastocyst implantation. This is followed by a secondary wave of decidualization that proceeds mesometrially to form the decidua basalis [15].
WNT-related and calcium regulating molecules are expressed in the decidualizing uterus. In pregnant mice, stanniocalcin-1 (STC1), a calcium regulator, is expressed by mesometrial stromal cells [16], suggesting calcium may play a role in decidualization. In the rat uterus, extracellular CaSR is hormonally regulated and expressed by decidualizing stromal cells [17]. The canonical WNT signaling molecule CTNNB1 [18] and inhibitor of WNT signaling, Dickkopf homologue 1 (DKK1), are expressed in the human endometrium [19]. The latter promotes trophoblast invasion in mice [20] and is regulated positively by progesterone in human endometrial stromal cells [21]. In mice, Wnt5a is expressed in the decidua [22], however expression of its receptor, ROR2, has not been addressed.
The goal of this investigation was to evaluate the expression of ROR2 in the virgin and pregnant mouse uterus and to identify the cell populations expressing this receptor. Given the expression of Wnt5a in the decidua, we hypothesized that its receptor, ROR2, would also be present. By identifying the cell populations expressing ROR2, functions for WNT signaling in uterine biology can be postulated and advance our understanding of decidualization and pregnancy.
2. Materials and methods
2.1. Mice and tissue collection
C57BL6/J mice aged 6–8 weeks were purchased from the Jackson Laboratory (Bar Harbor, ME, USA) and were housed under conventional conditions and used under protocols fully approved by the Queen's University Animal Care Committee. Tissue was collected from virgin (n = 15), gestation day (gd) 6 (n = 9), gd10 (n = 18) and gd12 (n = 9) mice. For tissues from virgin females, the estrous cycle stage was determined by visual examination of the vulva, microscopic examination of vaginal smears and histological characterization of the uterine glands, stroma and epithelium [23], [24], [25]. For gestational tissues, estrous females were paired with males and examined the following morning for a copulation plug. The day of plug detection was designated gestation day (gd)0. Uteri were used for RNA isolation, flow cytometry or immunohistochemistry. Spleens were collected from virgin mice and prepared for immunofluorescent wet-mount studies or flow cytometry.
Additionally, 8 week old female Rag2−/−Il2rg−/− knock-out mice (n = 3) genetically devoid of T, B and NK cells were used. These mice were treated with 5-fluorouracil (5FU; 150 mg/kg intraperitoneally) to eliminate progenitor cells. 48 h after 5FU, the mice were given bone marrow intravenously from an adult syngeneic male wild type (WT) donor (n = 3). The bone marrow recipient female mice were subsequently mated by a male Rag2−/−Il2rg−/− mouse and implantation sites were collected and used for immunohistochemistry on gd12. Bone marrow was prepared by flushing femurs and tibias. Red blood cell lysis was performed under hypotonic conditions (NH4Cl 0.15 m, KHCO3 10 mm, EDTA 0.1 mm) and 2 × 107 viable white cells were used for injection.
2.2. PCR detection of Ror2, Wnt3a, Wnt5a and Dkk1 transcript
Primers for Ror2 (forward 5′TCCTTCTGCCACTTCGTCTT3′, reverse 5′TTGTAGCACTGGTGGTAGCG3′; size = 266 bp) were designed using Primer-BLAST (www.ncbi.nlm.nih.gov/tools/primer-blast). Primers for Wnt3a, Wnt5a and Dkk1 were designed by others [20], [26], [27]. As an internal control, Gapdh targeting primers were also used (forward 5′GGTCGGTGTGAACGGATTTGGC3′, reverse 5′GTGGGGTCTCGCTCCTGGAAGA3′; size = 234 bp).
Gestation day 10 implantation sites were dissected and the MLAp, decidua basalis and placenta were collected aseptically. Total RNA was extracted using an RNeasy Mini Kit (Qiagen; Mississauga, ON, Canada). Complementary DNA was synthesized from 1.5 μg total RNA using SuperScript® III First-Strand Synthesis System (Invitrogen; Burlington, ON, Canada). PCR was performed to amplify the cDNA using the Qiagen Taq DNA polymerase PCR kit under the following conditions: 94 °C for 3 min (1 cycle); 94 °C for 30 s, 55 °C for 30 s, 72 °C for 30 s (32 cycles); and 72 °C for 10 min (1 cycle). PCR products were separated on a 1.0% agarose gel and visualized by ethidium bromide staining. PCR product bands were confirmed by sequencing.
2.3. Immunohistochemistry
Tissue was fixed using 4% paraformaldehyde (pH 7.4, 4 °C, 16 h) and processed and embedded into paraffin blocks. Paraffin blocks were sectioned at 7 μm and mounted onto charged glass slides, baked dry, de-waxed using xylene and rehydrated in graded ethanol concentrations. For peroxidase-based detection, slides were treated with 3% hydrogen peroxide for 30 min to quench endogenous peroxidase activity before being washed and blocked with 1% bovine serum albumin (BSA) for 30 min at room temperature. The sections were incubated with rabbit-anti-ROR2 antibody (1:200, Cell Signaling; Boston, MA, USA) overnight at 4 °C followed by biotinylated goat-anti-rabbit secondary antibody for 2 h at room temperature (1:200, DAKO; Mississauga, ON, Canada), ExtrAvidin Peroxidase for 30 min at room temperature (1:50, Sigma; Oakville, ON, Canada) and diaminobenzidine for detection (Liquid DAB + Substrate, DAKO; Mississauga, ON, Canada). Slides were counterstained in Harris' hematoxylin for 10 s, dehydrated, mounted and coverslipped. For fluorescence based detection, hydrogen peroxide pre-treatment was omitted. The rabbit-anti-ROR2 primary antibody was followed with fluorescent Alexa 594 goat-anti-rabbit antibody (1:200, Molecular Probes; Burlington, ON, Canada) for 2 h at room temperature. Sections were then incubated with fluorescein isothiocyanate (FITC) conjugated Dolichos biflorus agglutinin (DBA) lectin (1:200, Sigma; Oakville, ON, Canada) for 2 h at room temperature to detect uterine NK cells. To quench autofluorescence, slides were incubated with 20 mM l-lysine (Sigma; Oakville, ON, Canada) for 30 min at room temperature before being coverslipped with 4′,6-diamidino-2-phenylindole (DAPI) added mounting media (DAPI Gold with Anti-Fade Agent, Molecular Probes; Burlington, ON, Canada).
2.4. Wet-mount immunofluorescence
Spleens were cut into pieces and sieved through a wire mesh to achieve single cell suspensions. Red blood cell lysis was performed using hemolytic conditions and the white cell enriched splenocytes were used for analysis. Cell suspensions were blocked using 20% bovine serum, then stained using PE conjugated anti-NK1.1 antibody (1:100, BD Pharmingen; Mississauga, ON, Canada) and rabbit-anti-Ror2 antibody (1:100) for 1hr, followed with Alexa 488 goat-anti-rabbit antibody (1:100, Molecular Probes; Burlington, ON, Canada) for 30 min and DAPI added mounting media. Negative, isotype and single stained controls were also prepared. Slides were imaged under fluorescence using Axiovision computer software (Zeiss; Toronto, ON, Canada).
2.5. Flow cytometry
Splenocyte cell suspensions were prepared as described above. Cells were fixed using 4% paraformaldehyde for 20 min before fluorescent labeling was performed as described above. Flow cytometry was performed using a Cytomics FC 500 cytometer (Becton Dickinson; Mississauga, ON, Canada) and results were analyzed using FlowJo software (Tree Star; Ashland, OR, USA).
3. Results
3.1. Ror2, Wnt3a, Wnt5a and Dkk1 transcripts are expressed in the pregnant mouse uterus
Using reverse transcription (RT) PCR, we first asked if Ror2, Wnt3a, Wnt5a and Dkk1 transcripts were expressed at mid pregnancy (Fig. 1). Gestation day (gd)10 C57BL6 mouse implantation sites dissected as the mesometrial lymphoid aggregate of pregnancy (MLAp), decidua basalis and placenta were homogenized and RNA was extracted. RT-PCR revealed transcripts for Ror2, Wnt5a and Dkk1 were expressed in all tissue types. Wnt3a was not detectable in the maternal MLAp or decidua, however it was detected in fetal placental tissue. We proceeded to confirm that ROR2 protein was expressed in these tissues. Using peroxidase based immunohistochemistry, we determined that in gd10 implantation sites ROR2 expression was localized to cells that appeared to be uterine Natural Killer (NK) cells and to placental labyrinthine cells lining the maternal vascular space as recognized by nucleated red blood cells (Fig. 2). Trophoblast giant cells were occasionally positive (not shown).

Fig. 1
Expression of Ror2, Wnt3a, Wnt5a and Dkk1 transcripts in the pregnant mouse uterus. Complementary DNA from gd10 MLAp, decidua and placenta was amplified for WNT- related genes.

Fig. 2
Gestation day 10 mouse uterus was stained for ROR2 using immunohistochemistry. Peroxidase-DAB detection localized ROR2 expression to uterine NK-like cells (arrows) in the MLAp (A) and decidua (B). Placental labyrinth cells expected but not confirmed to be trophoblast cells (arrowheads) lining the maternal circulation (C) were also positive. Size bar = 50 μm.
3.2. Uterine NK cells express ROR2 but splenic NK cells do not
To confirm that uterine NK cells expressed ROR2, a uterine NK cell specific marker, D. biflorus agglutinin (DBA) lectin, was used. Co-localization of fluorescently tagged DBA lectin positive and ROR2 expressing cells showed that uterine NK cells did indeed express ROR2 (Fig. 3A). We asked if NK cells found in lymphoid organs were ROR2 positive using splenic NK cells. Co-localization of NK1.1 and ROR2 by immunofluorescent staining and by flow cytometry showed that splenic NK1.1 positive cells were ROR2 negative (Fig. 3B, C).

Fig. 3
Fluorescent immuno-detection reveals uterine NK cells express ROR2 while splenic NK cells do not. No differences were observed between spleens collected from virgin and pregnant animals. Shown here are virgin splenocytes. Using immunohistochemistry, gd10 implantation sites were stained for ROR2 expression and uterine NK cells (using DBA lectin) and counterstained using DAPI. Co-localization of these markers revealed uterine NK cells express ROR2 (A; bar = 20 μm). To ask if splenic NK cells also expressed ROR2, immunohistochemistry (B; bar = 5 μm) and flow cytometry (C) was done using a peripheral NK cell marker, NK1.1, on splenocytes. Splenic NK1.1 + cells were negative for ROR2.
For further confirmation that uterine NK cells expressed ROR2, female Rag2−/−Il2rg−/− mice genetically devoid of T, B and NK cells were used. Gestation day 12 implantation sites of these mice lacked ROR2 positive DBA lectin staining uterine NK cells (not shown). However, when mice were engrafted with syngeneic, wild type (WT), bone marrow intravenously and subsequently mated by a male Rag2−/−Il2rg−/− mouse, gd12 implantation sites were populated with ROR2 expressing DBA lectin + uterine NK cells (Fig. 4).

Fig. 4
ROR2 expressing uterine NK cells are absent in Rag2−/−Il2rg−/− mice, but appear after engraftment of WT bone marrow. Rag2−/−Il2rg−/− mice, genetically deficient in T, B and NK cells, also lack ROR2 expressing uterine NK cells. Adult mice conditioned with chemotherapeutic agent, 5-Fluorouracil (5FU), receive bone marrow intravenously 48 h later. These mice are then set up for pregnancy and their uteri become populated with ROR2 expressing uterine NK cells. The absence of these cells in pregnancies of knock-out mice (not shown) is further support that uterine NK cells express ROR2. Immunohistochemistry shows gd12 decidua basalis. Size bar = 20 μm.
3.3. ROR2 is expressed in the virgin and pregnant uterus by multiple cell types
To ask if any additional cell populations expressed ROR2, fluorescent immunohistochemistry was performed on virgin, gd6 and gd12 uteri (Fig. 5). In virgin mice, the basal side of the uterine epithelium was positive for ROR2. Uterine stromal cells were rarely positive for ROR2 in virgin uterus, but were frequently positive for ROR2 at gd6 in the mesometrial decidua. Weaker ROR2 staining was found in the anti-mesometrial decidua. In the virgin uterus, uterine gland epithelial cells were positive for ROR2 on the basal side; however at gd6, they were ROR2 positive on both the basal and luminal sides. Gestation day 6 uterine NK cells expressed ROR2. At gd12, uterine NK cells in both the MLAp and decidua basalis expressed ROR2. The myometrium was also positive for ROR2.

Fig. 5
Time-course fluorescent immunohistochemistry staining of the uterus. Virgin, gd6 and 12 uteri were stained for ROR2 (red). DBA lectin staining (green) was used to localize uterine NK cells and DAPI (blue) nuclear counterstaining was performed. In the virgin stroma, ROR2 expressing cells are rare (arrow). ROR2 expression was observed on the basal side of uterine gland and endometrial epithelial cells. Gestation day 6 mesometrial stroma showed positive ROR2 staining in both stromal cells (arrow) and uterine NK cells (arrowhead). At gd6, compared to the mesometrial stroma, the anti-mesometrial stroma appeared weaker in ROR2 expression. Uterine glands at gd6 expressed ROR2 on both the luminal and basal side. In gd12 implantation sites, MLAp area stromal cells (arrow) and uterine NK cells (arrowhead) expressed ROR2. Gestation day 12 uterine NK cells in the decidua also expressed ROR2. The uterine wall was also ROR2 positive. Size bar = 50 μm.
3.4. ROR2 expression is maintained in the estrous cycle
The expression of ROR2 in the virgin uterus over the course of the estrous cycle was examined using peroxidase based immunohistochemistry (Fig. 6). ROR2 expression appeared to be dynamic and maintained on the basal side of uterine gland and endometrial epithelial cells throughout the estrous cycle.

Fig. 6
Peroxidase ROR2 immunohistochemisty of virgin mouse uteri. Expression of ROR2 was localized to the basal side of endometrial and uterine gland epithelial cells throughout the estrous cycle. Size bar = 20 μm.
4. Discussion
In this investigation, we report several novel observations on the expression of ROR2. We document ROR2 expression in the uterus: on uterine stromal cells, gland and endometrial epithelial cells, uterine NK cells, labyrinth cells lining the maternal vascular space and the myometrium. ROR2 expression is maintained throughout the estrous cycle of virgin mice, however during pregnancy the ROR2 positive endometrium at implantation sites is replaced by ROR2 expressing uterine NK cells and labyrinth cells lining the maternal vascular space that are expected but not confirmed to be trophoblast cells. In this way, the expression of ROR2 by maternal uterine cells changes in response to pregnancy. This investigation is also the first to ask if ROR2 is expressed in immune cells. Although DBA lectin + uterine NK cells expressed ROR2, NK1.1 + cells of the spleen were negative.
The function of ROR2 expression on the basal side of uterine endometrial epithelial cells is yet to be determined; however there are several postulates. One possibility is that ROR2 plays a role in cell polarization. Non-canonical WNT signaling via van Gogh like 2 (VANGL2) regulates cell polarity in the uterine epithelium during embryonic development [28]. Perhaps ROR2-mediated, non-canonical, WNT signaling is maintained on the basal side of the uterine endometrium to preserve cell polarity as the epithelium forms, dies and regenerates. In silico analysis of ROR2 using ExPASy [29] generated an instability index of 53.24, which classifies the protein as unstable with an estimated half-life of 1 h. Considering this, the interpretation would be that it is not the case that the protein is transcribed early and maintained, rather, ROR2 expression is dynamic, possibly as a consequence of WNT signaling events that occur continuously.
Functionally, uterine NK cells play important roles in angiogenesis, vascular remodeling and regulation of trophoblast invasion [30], [31], [32]. It has been reported WNT5A is involved in regulation of angiogenesis [33], trophectoderm migration [34] and in endothelial cell proliferation [35], [36] and migration [35]. These activities seen in WNT5A activated cells fit well with our observation that uterine NK cell express ROR2, a receptor for WNT5A. Furthermore, the observation that splenic NK cells do not express ROR2 suggests that ROR2-related WNT signaling is responsible for uterine NK cell functions that phenotypically distinguish this lineage from peripheral NK cells. During embryonic development, cell migration within the cleft palate is directed by a WNT5A gradient along the anteroposterior axis via ROR2 signaling [6]. Whether WNT5A directs movement of ROR2 expressing uterine NK cells in the decidua is yet to be determined. Although we detected the presence of Wnt5a in the MLAp and decidua, we were unable to detect Wnt3a in these tissues. Since uterine NK cells are abundant in these tissues but rare in placenta [37], we postulate that non-canonical, CTNNB1-independent, WNT cell signaling is more likely to be occurring within uterine NK cells.
In conclusion, we report the presence of a new WNT signaling protein in the uterus; ROR2. Others have shown that the uterus is equipped for canonical WNT signaling, however in our present study we show that a major player in non-canonical WNT signal transduction, ROR2, is present on the endometrial and uterine gland epithelium, uterine NK and stromal cells, labyrinthine cells of the placenta lining the maternal circulation and myometrium. However, the signal(s) which direct and determine how and where non-canonical WNT signaling occurs in the uterus is yet to be determined. Further investigation on the functional consequence of the presence of this receptor on many different cell types of the uterus merits further investigation.
Conflict of interests
None of the authors have conflicts of interest regarding the reported data.
Acknowledgments
This work was supported by the Natural Sciences and Engineering Research Council of Canada (BAC) and the Canada Research Chairs Program (BAC, RJM).
References
- Ror2, encoding a receptor-like tyrosine kinase, is required for cartilage and growth plate development. Nature Genetics. 2000;24:271–274
- Dominant mutations in ROR2, encoding an orphan receptor tyrosine kinase, cause brachydactyly type B. Nature Genetics. 2000;24:275–278
- Mutation of the gene encoding the ROR2 tyrosine kinase causes autosomal recessive Robinow syndrome. Nature Genetics. 2000;25:423–426
- . Robinow syndrome. Journal of Medical Genetics. 2002;39:305–310
- The receptor tyrosine kinase ROR2 associates with the melanoma-associated antigen (MAGE) family protein dlxin-1 and regulates its intracellular distribution. Journal of Biological Chemistry. 2003;278:29057–29064
- Wnt5a regulates directional cell migration and cell proliferation via Ror2-mediated noncanonical pathway in mammalian palate development. Development. 2008;135:3871–3879
- Ror2 modulates the canonical Wnt signaling in lung epithelial cells through cooperation with Fzd2. BMC Molecular Biology. 2008;9:11
- The receptor tyrosine kinase Ror2 is involved in non-canonical Wnt5a/JNK signalling pathway. Genes Cells. 2003;8:645–654
- . CaSR stimulates secretion of Wnt5a from colonic myofibroblasts to stimulate CDX2 and sucrase–isomaltase using Ror2 on intestinal epithelia. AJP – Gastrointestinal and Liver Physiology. 2008;295:G748–G759
- . Wnt5a secretion stimulated by the extracellular calcium-sensing receptor inhibits defective Wnt signaling in colon cancer cells. AJP – Gastrointestinal and Liver Physiology. 2007;293:G403–G411
- . The endometrium. London: Taylor & Francis; 2002;
- Global gene profiling in human endometrium during the window of implantation. Endocrinology. 2002;143:2119–2138
- Uterine natural killer cells and angiogenesis in recurrent reproductive failure. Human Reproduction. 2009;24:45–54
- Angiogenesis in implantation. Journal of Assisted Reproduction and Genetics. 2007;24:303–315
- . Manipulating the mouse embryo: a laboratory manual. 3rd ed.. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press; 2003;
- . Dynamic changes in stanniocalcin gene expression in the mouse uterus during early implantation. Molecular and Cellular Endocrinology. 2001;174:145–149
- . Extracellular Ca2+-sensing receptor expression and hormonal regulation in rat uterus during the peri-implantation period. Reproduction. 2005;129:779–788
- Embryo-uterine cross-talk during implantation: the role of Wnt signaling. Molecular Human Reproduction. 2009;15:215–221
- Identification, characterization, and regulation of the canonical Wnt signaling pathway in human endometrium. Journal of Clinical Endocrinology Metabolism. 2003;88:3860–3866
- Dickkopf-1 secreted by decidual cells promotes trophoblast cell invasion during murine placentation. Reproduction. 2008;135:367–375
- . Dickkopf-1, an inhibitor of Wnt signaling, is regulated by progesterone in human endometrial stromal cells. Journal of Clinical Endocrinology Metabolism. 2006;91:1453–1461
- Wnt genes in the mouse uterus: potential regulation of implantation. Biology of Reproduction. 2009;80:989–1000
- . The oestrous cycle in the mouse. American Journal of Anatomy. 1922;30:297–371
- . Abnormal estrous cyclicity after disruption of endothelial and inducible nitric oxide synthase in mice. Biology of Reproduction. 1999;61:171–177
- . Disruption of the tissue inhibitor of metalloproteinase-1 gene results in altered reproductive cyclicity and uterine morphology in reproductive-age female mice. Biology of Reproduction. 2000;63:905–912
- . The loss of glypican-3 induces alterations in Wnt signaling. Journal of Biological Chemistry. 2005;280:2116–2125
- . Aggregated P19 mouse embryonal carcinoma cells as a simple in vitro model to study the molecular regulations of mesoderm formation and axial elongation morphogenesis. Genesis. 2009;47:93–106
- . Sassoon DA. Non-canonical Wnt signaling regulates cell polarity in female reproductive tract development via van Gogh-like 2. Development. 2009;136:1559–1570
- . ExPASy: the proteomics server for in-depth protein knowledge and analysis. Nucleic Acids Research. 2003;31:3784–3788
- . Uterine natural killer cells: a specialized differentiation regulated by ovarian hormones. Immunological Reviews. 2006;214:161–185
- . Natural killer cells and pregnancy. Nature Reviews Immunology. 2002;2:656–663
- Decidual NK cells regulate key developmental processes at the human fetal-maternal interface. Nature Medicine. 2006;12:1065–1074
- Wnt5a expression is associated with the tumor proliferation and the stromal vascular endothelial growth factor–an expression in non-small-cell lung cancer. Journal of Clinical Oncology. 2005;23:8765–8773
- . WNTs in the ovine uterus: potential regulation of periimplantation ovine conceptus development. Endocrinology. 2007;148:3496–3506
- . Wnt5a-mediated non-canonical Wnt signalling regulates human endothelial cell proliferation and migration. Biochemical and Biophysical Research Communications. 2008;365:285–290
- Wnt5a signaling induces proliferation and survival of endothelial cells in vitro and expression of MMP-1 and Tie-2. Molecular Biology of the Cell. 2006;17:5163–5172
- . Subset classification of mouse uterine natural killer cells by DBA lectin reactivity. Placenta. 2003;24:479–488
PII: S0143-4004(10)00038-X
doi:10.1016/j.placenta.2010.01.012
© 2010 Elsevier Ltd. All rights reserved.
