Expression of thyroid hormone transporters in the human placenta and changes associated with intrauterine growth restriction
Article Outline
- Abstract
- 1. Introduction
- 2. Material and methods
- 3. Results
- 4. Discussion
- Acknowledgements
- References
- Copyright
Abstract
Thyroid hormones (TH) are important for the development of the human fetus and placenta from very early gestation. The transplacental passage of TH from mother to fetus and the supply of TH into trophoblasts require the expression of placental TH plasma membrane transporters. We describe the ontogeny of the TH transporters MCT8, MCT10, LAT1, LAT2, OATP1A2 and OATP4A1 in a large series (n = 110) of normal human placentae across gestation and describe their expression changes with intrauterine fetal growth restriction (IUGR n = 22). Quantitative RT-PCR revealed that all the mRNAs encoding TH transporters are expressed in human placenta from 6 weeks gestation and throughout pregnancy. MCT8, MCT10, OATP1A2 and LAT1 mRNA expression increased with gestation. OATP4A1 and CD98 (LATs obligatory associated protein) mRNA expression reached a nadir in mid-gestation before increasing towards term. LAT2 mRNA expression did not alter throughout gestation. Immunohistochemistry localised MCT10 and OATP1A2 to villous cytotrophoblasts and syncytiotrophoblasts, and extravillous trophoblasts while OATP4A1 was preferentially expressed in the villous syncytiotrophoblasts. Whilst MCT8 protein expression was increased, MCT10 mRNA expression was decreased in placentae from IUGR pregnancies delivered in the early 3rd trimester compared to age matched appropriately grown for gestational age controls. No significant change was found in the mRNA expression of the other transporters with IUGR. In conclusion, several TH transporters are present in the human placenta from early 1st trimester with varying patterns of expression throughout gestation. Their coordinated effects may regulate both transplacental TH passage and TH supply to trophoblasts, which are critical for the normal development of the fetus and placenta. Increased MCT8 and decreased MCT10 expression within placentae of pregnancies complicated by IUGR may contribute to aberrant development of the fetoplacental unit.
Keywords: Placenta, IUGR, Thyroid hormones, Transporter, Expression, Monocarboxylate transporters, System-L amino acid transporters, Organic anion transporting polypeptides
1. Introduction
Thyroid hormones (TH) are essential for normal human fetal growth and development, particularly the central nervous system (CNS). Even minor perturbations in maternal thyroid status are associated with neurodevelopmental abnormalities in children in later life [1], [2]. These effects are most pertinent when maternal thyroid dysfunction occurs before the onset of endogenous fetal TH production in the mid-trimester of pregnancy [3]. Current evidence points to a direct role for maternal TH in human fetal CNS development from the 1st trimester of pregnancy [4], [5] and this necessitates the transplacental passage of maternal TH to the fetus. Transplacental transport of maternal TH is evidenced by the finding of a biologically significant concentration of free thyroxine (T4) in fetal coelomic fluid and in fetal tissues from as early as five weeks of gestation [6], [7]. Even at term, the concentration of maternally-derived T4 in the circulation of fetuses with absent endogenous thyroid function reaches 25–50% of normal [8].
The human placenta is also a TH responsive organ, with both villous and extravillous trophoblasts (EVTs) expressing specific TH nuclear receptor isoforms for triiodothyronine (T3, the active ligand) [9]. TH can affect human trophoblast proliferation, migration and invasion in vitro [10], [11], [12]. These characteristics, expressed principally by human EVTs, play a key role in maternal spiral artery remodelling. Deficiencies in this process lead to malplacentation syndromes. Clinical conditions associated with malplacentation (including miscarriage, pre-eclampsia, placental abruption, intrauterine growth restriction (IUGR) and stillbirth) are associated with untreated maternal thyroid disorders [13]. Even subclinical hypothyroidism is associated with miscarriage and preterm delivery [14], [15], suggesting that utero-placental tissues are sensitive to minor perturbations in maternal thyroid function.
The human haemochorial placenta forms a barrier across which any maternal-fetal exchange must take place. The cellular uptake of T4 and T3 by the placenta is thus critical for both TH action within this organ and for TH transport to the fetus. There is clear evidence that the cellular influx and efflux of TH occur mostly through plasma membrane transporters [16]. The importance of TH transporters during development has been supported by the discovery of mutations in the gene encoding the TH transporter, MCT8, resulting in subjects displaying severe global neurological impairment accompanied by elevated serum free T3 but low free T4 concentrations [17], [18], [19]. Although to date it has been assumed that the phenotype is due primarily to defective TH transport into neurons within the CNS [20], the possibility of impaired TH transport across the placenta also has to be considered.
The ability to transport TH has been described in members of different transporter groups including the monocarboxylate transporters (MCT), L-type amino acid transporters (LAT) and organic anion transporting polypeptides (OATP). With the exception of MCT8, these transporters do not exclusively transport TH and they all have slightly different affinities for specific forms of TH (Table 1). To date six different TH transporters are known to be present in the placenta: MCT8, MCT10, LAT1, LAT2, OATP1A2 and OATP4A1 but their relative contributions to placental TH transport are unknown [21], [22], [23], [24], [25], [26]. We have previously reported an increase of MCT8 mRNA expression with advancing gestation [21] but there is limited information regarding the ontogeny of the other TH transporters.
Table 1. Characteristics of the thyroid hormone transporters present in the placenta.
| Protein | Gene | Km for T4 (μM) | Km for T3 (μM) | Km for rT3 (μM) | Other compounds transported | Km (μM) for other compounds | References | Localisation in placenta | References |
|---|---|---|---|---|---|---|---|---|---|
| MCT8 | SLC16A2 | 4.7 (rat) | 4.0 (rat) | 2.2 (rat) | Unknown | NA | [52] | ST, CT, EVT, decidual stroma | [21], [52] |
| MCT10 | SLC16A10 | *Higher than for T3 | *Lower or the same as MCT8 | ? | Aromatic amino acids | 450–750 | [53] | ST, CT, EVT, villous stroma, decidual stroma | [54], [34] |
| LAT1 | SLC7A5 | 7.9 | 0.8 | 12.5 | Large neutral amino acids | 30–94 | [22] | ST (apical) | [25], [41], [55] |
| LAT2 | SLC7A8 | ?? | |||||||
| OATP1A2 | SLCO1A2 | 8 | 6.5 | ? | organic anions, neutral compounds, cations | 5–60 | [56], [57] | ST, CT, EVT | [58], [59] |
| OATP4A1 | SLCO4A1 | ? | 0.9 | ? | Bile salts, Steroid conjugates, PGE2, benzylpenicllin | 14 | [56], [57] | ST | [58], [26] |
IUGR is often secondary to malplacentation with evidence of altered placental histology and cytoarchitecture [27]. Babies born with IUGR are major contributors to perinatal and neonatal mortality. Furthermore, IUGR survivors have neurodevelopmental scores that are significantly lower at age 3 and poorer school performances as teenagers compared to controls [28], [29]. Altered thyroid status is one of several factors postulated to play a role in this morbidity, especially in development and function of the CNS and placenta [5], [30]. We and others have reported a significant reduction in circulating concentrations of free T4 and T3 by in utero cordocentesis of fetuses affected by severe IUGR [9], [31]. We also reported that in the very severe cases of IUGR, which required delivery in the early 3rd trimester of pregnancy, placental MCT8 expression was significantly higher compared to gestationally-matched controls [21].
In this study, we determined the expression of the TH transporters MCT10, OATP1A2, OATP4A1, LAT1, LAT2 and the LATs obligatory associated protein, CD98, alongside MCT8 in a large series of normal human placentae across gestation. In order to determine whether aberrant expression of TH transporters within placentae from IUGR pregnancies may contribute to malplacentation and the development of hypothyroxinaemia in the fetus, we assessed the expression of TH transporters in placentae from pregnancies complicated by IUGR.
2. Material and methods
2.1. Collection of placental samples
This study was approved by the Local Research Ethics Committee (South Birmingham) and the Research and Development Committee of the Birmingham Women's Hospital. A total of 110 normal placental samples were collected and grouped as follows: 6–10 weeks of gestation (wks; n = 39), 11–14 wks (n = 18), 15–20 wks (n = 4), 27–34 wks (n = 9) and term (37–41 wks; n = 40). The gestational ages of the pregnancies were determined by 1st trimester ultrasound scan [21]. Placentae from 6 to 20 wks were obtained from surgical termination of pregnancy for reasons other than fetal abnormality (in accordance with the Polkinghome Report and the Human Tissue Act, UK). The normal early 3rd trimester group (27–34 wks) consisted of placentae with appropriately grown fetuses for gestational age (AGA) which were obtained following emergency caesarean section for placenta praevia (n = 3), maternal tumours (n = 3) and prelabour rupture of membranes (with no clinical evidence of infection) with a breech presentation (n = 3). The normal late 3rd trimester group (37–41 wks) consisted of placentae from normal pregnancy delivered by elective caesarean section for previous caesarean section, breech presentation or patient choice.
Twenty-two cases of IUGR in the absence of maternal hypertension were diagnosed prospectively using ultrasound as described previously [32]. Cases satisfied at least three of the following four criteria: i) fetal abdominal circumference ≤ the 3rd centile for gestation, ii) reduced abdominal circumference growth velocity over 14 days, iii) oligohydramnios and iv) abnormal umbilical artery Doppler velocity waveforms. None of the babies had known chromosomal or structural abnormalities. These criteria selected a severe and relatively homogenous phenotype. Seventeen IUGR placentae were collected at 25–32 wks (early onset) and five at 37–38 wks (late onset). The early onset IUGR group represents a more severe phenotype within the IUGR disease spectrum with a 53% neonatal mortality rate.
All placentae were collected from pregnancies delivered by caesarean section without labouring. Immediately after delivery, multiple random biopsies were obtained by dissecting the placental tissue off the chorionic plate then washed, snapped frozen and stored at −80 °C as previously described [32].
Compared to our previous report describing the placental expression of MCT8 [21], our present series of normal and IUGR placentae is increased by 55% (from 71 to 110) and 120% (from 10 to 22) respectively, and includes the previously analysed samples. In view of this significant rise in sample size, we repeated our study of MCT8 alongside the other TH transporters.
In addition, for immunohistochemistry, matched placental and placental bed biopsies were obtained following elective pregnancy termination at 8–12 wks and after elective caesarean section at term [33]. All placental bed biopsies were selected to include interstitial EVTs, ‘transformed’ decidual and/or myometrial spiral arteries containing endovascular and/or intramural EVTs.
2.2. RNA extraction
Approximately 100 mg of placental tissue were homogenised and total RNA was extracted with TRI reagent (Sigma–Aldrich) following the manufacturer's guidelines. RNA (0.5 μg) was reverse transcribed using Avian Myeloblastosis Virus (AMV) reverse transcriptase (Promega) in a reaction volume of 20 μL following manufacturer's guidelines [32]. Following reverse transcription (RT) the reaction mixture was diluted 1:2 with RNAse free water.
2.3. Quantitative TaqMan PCR
Expression of mRNAs encoding MCT8, MCT10, OATP1A2, OATP4A1, LAT1, LAT2 and CD98 was determined using the ABI PRISM 7500 Sequence Detection System as described previously [32]. TaqMan PCR was carried out in duplicate using 1 μL of the RT reaction in a reaction volume of 25 μL in 96 well plates; the reaction buffer contained 1× TaqMan Universal PCR Master Mix (Applied Biosystems, UK), 150 nM TaqMan probe (5′ FAM/3′ TAMRA labelled; Eurogentec, UK) and 900 nM primers (AltaBioscience, UK). Each probe and primer set was designed with Primer Express v2.0 (ABI) with all amplicons crossing an exon–exon boundary (Table 2) and validated alongside control RT reactions without AMV. All samples were analysed for 18S rRNA with a VIC-labelled-probe and primers (ABI) as an internal control either in singleplex (OATP1A2, OATP4A1 and LAT2) or multiplex (MCT8, MCT10, LAT1 and CD98). Amongst several housekeeping genes we investigated, 18S ribosomal RNA gave the best stability value and the least intra- and inter-group variability in agreement with a previously published report [23].
Table 2. Real-time RT-PCR Primers and probes sequences.
| Gene | Accession number | Forward primer | Reverse primer | Probe | Amplicon length (bp) |
|---|---|---|---|---|---|
| MCT8 | NM006517 | CAACGCACTTACCGCATCTG | GTAGCCCCAATACA ACCAAGAG | TCCACATACTTCATCAGGTGTACATAGGGAACAAA | 150 |
| MCT10 | NM018593 | GATTCATGTCTATACCCATGACTGTTG | CACATCATAGGAGCCCAGTTTGT | CCCACCCATTGCAGGGTTACTTCGT | 77 |
| OATP1A2 | NM134431 | GTGAACACAGATGATCTGATCATAACTC | AACTCCTGCACAAATCAGAAAGC | ATGCACCGACCCAACGAGTGTCAGT | 87 |
| OATP4A1 | NM016354 | GCAGCCACGGAGACGAA | AAAGATTCTGAGGGATACAGCTACAGT | CTCGGTACACCTTCTGGCCGTCCA | 70 |
| LAT1 | NM003486 | AAATGATCAACCCCTACAGAAACCT | ACGTACACCAGCGTCACGAT | CCTGGCCATCATCATCTCCCTGCC | 73 |
| LAT2 | NM012244 | AAATCTGGAGGTGACTACTCCTATGTC | GATCACCAGCACAGCAATCC | AGCCTCAGGAACCCAGCCAGTCCT | 87 |
| CD98 | NM001012661 | TGAGATTGGCCTGGATGCA | GGACTCATCCCACAGCATGAC | CCCTTCCTGGACAGCCTATGGAGGC | 73 |
Data were expressed as Ct values and relative quantifications of each gene were determined using the ▵Ct method. For each sample, fold changes in gene expression were calculated with the equation 2−▵Ct (▵Ct = sample Ct − calibrator Ct). The calibrator was determined for each gene as the sample with the highest expression. For each sample, transporter gene expression was then normalised to 18S to correct for differences in RT efficiency. The mean gene expression for the normal term placenta samples was assigned the arbitrary value of 1. The relative mRNA expression for each sample compared to the mean for term placenta was calculated and used to perform statistical analysis.
2.4. Western blot
Placental proteins were extracted from randomly selected samples from each gestational group (6–10 wks n = 2; 11–14 wks n = 4; 15–20 wks n = 2; 27–34 wks n = 4; term n = 4). Placental tissues were homogenised in lysis buffer with protease inhibitors as previously described [21]. Protein samples (30 μg) were denatured (1 h, room temperature) in loading buffer (Laemmli sample buffer with dithiothreitol at 54 mg/mL), separated by electrophoresis in 10% SDS-PAGE gels and blotted on nitrocellulose membranes. Blots were then probed with primary antibody: rabbit polyclonal antisera to MCT8 (Ab4790), MCT10 (described in [34]), OATP1A2 or OATP4A1 (described in [35]) or anti-human CD98 goat polyclonal antibody (Santa Cruz). Primary antibodies were used at 1:500, with the exception of the anti-CD98 (1:250). Blots were then probed with secondary antibody conjugated to horseradish peroxidase and bands visualised using the ECL chemiluminescence detection kit (GE Healthcare Life Sciences). β-actin expression was used to assess protein loading. Relative densitometry for each protein normalised to β-actin was performed using GeneTools Analysis software (Syngene, Synoptics Ltd). To demonstrate the specificity of the MCT8 antibody, Ab4790 was tested on MCT8-null JEG-3 choriocarcinoma cells transfected with pcDNA3.1-hMCT8 that encodes the human MCT8 protein [36]. This revealed a band at ∼60 kDa on Western blot (Fig. 1E), consistent with the expected size of the MCT8 protein, which disappeared following pre-incubation with the blocking peptide (data not shown).

Fig. 1
MCT8 and MCT10 ontogeny in human placenta. A, B: Relative mRNA expression (mean ± sem) in human placentae from 6 to 34 wks compared to term, given an arbitrary value of 1; **p < 0.01, ***p < 0.001 compared to term; +p < 0.05 and ++p < 0.01 compared to 27–34 wks. C, D: Western blot on placental homogenates from normal human placentae (8–40 wks) demonstrating a band at ∼60 kDa for MCT8 (C) and ∼50 kDa for MCT10 [34] (D). Immunoblotting for β-actin on the same blot was used to assess protein loading. E: Specificity of the MCT8 polyclonal antibody was tested in MCT8-null JEG-3 cells transfected with empty vector (VO) or MCT8 plasmid (MCT8) and placental homogenates from normal human term placentae (Term PL). F, G: Densitometry of the protein bands shown in C and D respectively; *p < 0.05. H: Representative sections demonstrating MCT10 immunoreactivity in 1st trimester (H1), term (H2) placenta and in 1st trimester placental bed (H3). Villous cytotrophoblasts are shown by arrows, syncytiotrophoblasts by arrowheads and EVTs in placental bed by thick arrows. All photographed with 40× objective lens.
2.5. Immunohistochemistry
Formalin-fixed paraffin-embedded sections (3 μm) of placental and placental bed biopsies were immunostained for MCT10, OATP1A2 and OATP4A1 using an avidin–biotin peroxidase technique (Vectastain Elite, Vector Laboratories) as previously described [10], [21]. All reagents were prepared as per the kit instructions. Rabbit polyclonal primary antibodies to MCT10, OATP1A2 or OATP4A1 were used at 1:250, 1:150 and 1:300 respectively. Negative controls were performed for each sample by replacing the primary antibody with non-immune serum. Sections were lightly counterstained with Mayers haematoxylin, dehydrated, cleared and mounted in synthetic resin.
2.6. Statistical analyses
Since the gene expression data did not follow a normal distribution, non-parametric tests were employed using the Prism software (GraphPad Software Inc.). Comparisons between gestational age groups were performed by one-way Kruskal–Wallis ANOVA test with post-hoc Dunn's multiple comparison tests. Comparisons between IUGR and AGA samples were performed by two-way ANOVA with Bonferroni post-hoc tests. Significance was taken as p < 0.05. All the significant differences from post-hoc tests are indicated in the figures.
3. Results
Increased expression of mRNAs encoding MCT8 and MCT10 was demonstrated with advancing gestation (ANOVA p < 0.0001; Fig. 1A–B). Of all the TH transporters studied they also showed the greatest difference in expression between early gestation and term samples. Compared to term, MCT8 and MCT10 mRNAs were expressed 4-fold and 12-fold less respectively at 6–10 wks (p < 0.001 for both). By 27–34 wks, MCT8 and MCT10 mRNA expression had risen to levels similar to term. Western blot confirmed that both MCT8 and MCT10 proteins were expressed from the 1st trimester and throughout pregnancy (Fig. 1C–D). MCT8 protein expression increased with gestational age (p < 0.05), with expression in the 1st trimester being 29% less than at term (p < 0.05, Fig. 1F). There was also a trend of increased MCT10 protein expression with gestational age (p = 0.0685, Fig. 1G). Immunohistochemical analysis of 1st trimester placental biopsies indicated that MCT10 protein was present in both villous syncytiotrophoblasts and cytotrophoblasts, with more marked immunostaining in the cytotrophoblast layer (Fig. 1H1). In normal term placenta immunoreactivity remained in villous syncytiotrophoblasts (Fig. 1H2). Throughout gestation there was also relatively weak immunoreactivity within stromal cells of the villous placenta. In the 1st trimester placental bed, MCT10 staining was also found in EVTs and decidual stroma (Fig. 1H3).
Placental expression of OATP1A2 mRNA was significantly lower before 14 wks compared to term (ANOVA p < 0.01, Fig. 2A); being expressed 1.8-fold less at 6–10 wks compared to term (p < 0.05) but rising to term levels by 27–34 wks. In contrast, OATP4A1 mRNA demonstrated different changes with gestation (ANOVA p < 0.01; Fig. 2B): OATP4A1 expression at 6–10 wks was similar to term levels but was reduced by 5-fold at 11–14 wks compared to term (p < 0.05) thus reaching a nadir in mid-gestation before increasing towards term levels by 27–34 wks.

Fig. 2
OATP1A2 and OATP4A1 ontogeny in human placenta. A, B: Relative mRNA expression (mean ± sem) in human placentae from 6 to 34 wks compared to term, given an arbitrary value of 1; *p < 0.05 compared to term. C, D: Western blot on placental homogenates from normal human placentae (8–39 wks) demonstrated multiple bands between 60 and 85 kDa representing different glycosylated states with the OATP1A2 antibody [37], [38] and a single band at ∼60 kDa for OATP4A1 [35]. Immunoblotting for β-actin on the same blot was used to assess protein loading. Relative densitometry of the protein bands is shown below the corresponding blot. E, F: Representative sections demonstrating immunoreactivity of OATP1A2 and OATP4A1 in 1st trimester (E1, F1), term (E2, F2) placenta and in 1st trimester placental bed (E3, F3). Villous cytotrophoblasts are shown by arrows, syncytiotrophoblasts by arrowheads and EVTs in placental bed by thick arrows. All photographed with 40× objective lens.
The presence of OATP1A2 and OATP4A1 proteins throughout gestation in placenta from normal pregnancies was confirmed by Western blot (Fig. 2C–D). As described previously in brain and liver, several glycosylated forms of OATP1A2 were expressed [37], [38] and they were more abundant in samples before 20 wks than in 3rd trimester samples. Densitometry analysis of the bands between 60 and 85 kDa showed no statistical difference in OATP1A2 protein expression with gestational age. Equally, there was no statistically significant change in OATP4A1 protein expression with gestational age.
Immunohistochemistry demonstrated focal but strong immunoreactivity in villous syncytiotrophoblasts for both OATP1A2 and OATP4A1 in the 1st trimester, with immunostaining becoming more diffuse but weaker at term (Fig. 2E–F). Where present, OATP4A1 appeared preferentially localised to the apical surface of syncytiotrophoblasts. OATP1A2 demonstrated moderately strong immunostaining on villous cytotrophoblasts and EVTs throughout gestation (Fig. 2E) but immunostaining for OATP4A1 in these cells was weak (Fig. 2F).
Both light (LAT1, LAT2) and heavy (CD98) chains of the system-L amino acid transporters were expressed from 6 wks and throughout gestation (Fig. 3). Whereas quantification of LAT2 mRNA showed no change across gestation, quantification of LAT1 and CD98 mRNA indicated significant changes with advancing gestation (ANOVA p < 0.0001 and p < 0.05 respectively). LAT1 mRNA expression was lower before 20 wks; being expressed 2.6-fold less at 6–10 wks compared to term (p < 0.001) but increasing to term levels by 27–34 wks. CD98 mRNA expression was significantly reduced at 11–14 wks compared to term (p < 0.05), thus reaching a nadir in the late 1st trimester and very early 2nd trimester. CD98 Western blot confirmed the presence of protein from the early 1st trimester and throughout gestation, with no statistically significant differences with gestational age (Fig. 3E).

Fig. 3
LAT2, LAT1 and CD98 ontogeny in human placenta. A–C: Relative mRNA expression (mean ± sem) in normal human placentae from 6 to 34 wks compared to term, given an arbitrary value of 1; *p < 0.05, **p < 0.01, ***p < 0.001 compared to term. D: CD98 Western blot on placental homogenates from normal human placentae (8–39 wks) demonstrated a broad band with two distinct species at 75 and 100 kDa representing different glycosylation states of CD98 [25]. Immunoblotting for β-actin on the same blot was used to assess protein loading. Densitometry of the protein bands is shown below the blot.
To investigate whether changes in TH transporter expression are associated with malplacentation, we assessed the expression of the TH transporters in 3rd trimester placentae from both early (25–32 wks) and late onset (37–38 wks) IUGR pregnancies compared to gestationally-matched AGA pregnancies.
Quantification of mRNA encoding MCT8 in our current expanded series of placental samples showed no statistical differences between placentae from pregnancies complicated by IUGR and placentae from gestationally-matched AGA controls for both the early and late onset groups (Fig. 4A). However, densitometry analysis of Western blots showed a 27% increase in MCT8 protein expression in early onset IUGR compared to gestationally-matched AGA controls (p < 0.05) (Fig. 4–C). The late onset IUGR samples showed no difference in MCT8 protein expression compared to term AGA controls.

Fig. 4
MCT8 and MCT10 expression in IUGR and AGA placentae. A, D: Relative mRNA expression of MCT8 or MCT10 in early (25–32 wks) and late (37–38 wks) 3rd trimester IUGR placentae compared to gestationally-matched AGA controls (27–34 wks and 37–41 wks respectively). Scatter dot plots represent individual relative expression with mean (dotted line) and sem. B, E: Representative Western blots showing MCT8 and MCT10 protein in placental homogenates from early and late 3rd trimester AGA pregnancies and in those complicated by IUGR. Immunoblotting for β-actin on the same blots was used to assess protein loading. C, F: Relative densitometry analysis of MCT8 and MCT10 protein expression respectively. MCT8: pooled data from 2 separate Western blots including a total of 8 IUGR and 8 AGA samples; MCT10: pooled data from 3 separate Western blots including a total of 4 IUGR and 4 AGA samples; *p < 0.05.
In early onset IUGR the relative expression of MCT10 mRNA was 5-fold lower compared to gestationally-matched AGA controls (p < 0.05) (Fig. 4D). At the protein level, in keeping with mRNA data, the early onset IUGR samples showed a trend toward decreased MCT10 expression compared to gestationally-matched AGA controls (10% decrease, p = 0.094; Fig. 4–F). No statistically significant differences were seen with the late onset IUGR samples compared to AGA samples at both the mRNA and protein levels.
Messenger RNA encoding OATP1A2, OATP4A1, LAT1, LAT2 and CD98 were found at similar levels in placentae from IUGR pregnancies compared to gestationally-matched AGA controls (Fig. 5).

Fig. 5
OATP1A2, OATP4A1, LAT1, LAT2 and CD98 expression in IUGR and AGA placentae. Relative mRNA expression in IUGR human placentae (early: 25–32 wks and late: 37–38 wks 3rd trimester gestational groups) compared to gestationally-matched AGA controls (27–34 wks and 37–41 wks respectively); Scatter dot plots represent individual relative expression with mean (dotted line) and sem. Analysis using 2-way ANOVA showed no significant differences.
4. Discussion
In this study we have described the expression of six major TH transporters simultaneously in a large series of human placentae from as early as 6 wks and throughout gestation. This study is also the first to report on changes in the placental expression of TH transporters associated with IUGR.
Expression of mRNAs encoding MCT8, MCT10, OATP1A2 and LAT1 were significantly lower prior to 14 wks compared to term while OATP4A1 and CD98 mRNA expression at 6–10 wks was similar to term but fell to a nadir in the late 1st and early 2nd trimesters. Our findings are largely in agreement with previous studies on much smaller sample sizes collected across a limited range of gestational ages. Patel et al. [23] showed decreased mRNA expression of OATP1A2 but no change for OATP4A1 at 9–12 wks compared to term. In accord with our findings, CD98 mRNA has been reported throughout gestation [39] and lower placental expressions of CD98 and LAT1 protein at 12–21 wks compared to term have been reported [40]. Although the presence of mRNAs encoding MCT10 and LAT2 has been described in human term placenta [22], [24], this is the first report of their ontogeny across gestation.
We describe for the first time the localisation of MCT10 and OATP1A2 protein in both villous syncytiotrophoblasts and cytotrophoblasts, as well as in EVTs. Such widespread localisation is similar to what we have previously reported for MCT8 [21]. In contrast, OATP4A1 protein was preferentially localised in villous syncytiotrophoblasts throughout gestation, confirming a previous report on term placenta [26]. Other studies have also reported LAT1 and CD98 expression in the syncytiotrophoblast layer at term [25], [40] and LAT2 activity has been described in both the apical and basal membranes of the villous syncytiotrophoblast [41], [42].
The implications of the expression patterns of the TH transporters across gestation should be considered both in the context of placental development and of maternal to fetal transfer of TH. The differentiation of primary cytotrophoblasts into EVTs, that invade maternal uterine tissues and transform maternal spiral arteries, is a tightly regulated process. Both T3 and T4 stimulate EGF production by primary cytotrophoblasts, in turn enhancing their survival [11]. In primary EVTs, T3 has been shown to suppress apoptosis [43] and promote invasion [12], whilst in an EVT-like cell line, T3 in conjunction with EGF, suppresses proliferation and increases cell motility [10]. The expression of MCT8, MCT10 and OATP1A2 in both cytotrophoblasts and EVTs during the 1st trimester of pregnancy could allow TH cellular uptake into target cells and thus mediate TH action during early placental development. Moreover, the generally reduced levels of TH transporter expression at the time of invasion between 11 and 20 wks may reflect the need to regulate the pro-invasive effects of TH in order to prevent aggressive uncontrolled trophoblast invasion whilst promoting normal placentation.
The primary placental cell barrier to free maternal-fetal exchange is the syncytiotrophoblast layer of placental villi, which is in direct contact with maternal blood. Cytotrophoblasts form an additional inner layer of cells across which TH have to pass during the first half of pregnancy [44]. The presence of MCT8 [21], MCT10 (present report), OATP4A1 [26] and LAT1 [25] in villous syncytiotrophoblasts and MCT8 [21], MCT10 and OATP1A2 (present report) in cytotrophoblasts from the early 1st trimester indicate that the required molecular apparatus for maternal to fetal transfer of TH are present from very early human gestation. Preferential localisation of MCT8, OATP4A1 and LAT1 at the apical membrane of syncytiotrophoblasts [21], [25], [26] suggests that these transporters play a key role in TH uptake directly from maternal blood. MCT10, which is preferentially localised in cytotrophoblasts in the 1st trimester, may have a key role in TH efflux from the trophoblast cell barrier to the fetus.
The expression of multiple TH transporters at the trophoblastic cell barrier suggests that there is potential for redundancy in the TH uptake system from maternal blood. These TH transporters with different affinities for specific forms of TH (Table 1), as well as for other compounds which can act as competitive inhibitors (with the exception of MCT8), probably offers flexibility to ensure that the requisite amount of TH is available for fetal development at each stage of gestation. Since the fetal circulating TH concentration and fetal brain TH content is closely correlated to maternal free T4 rather than free T3, free T4 is believed to be the major form of TH transported across the placenta [3]. During pregnancy maternal free T4 levels fluctuate between 13.5 and 17.5 pmol/L [45]. Fetal free T4 levels reach approximately 40–50% of maternal concentrations by the early 2nd trimester [6] and peak in the early 3rd trimester to 19.3 pmol/L and remain at levels above corresponding maternal concentrations [45]. Although, maternal and fetal free T4 concentrations are well below the Km values of all the TH transporters, the relatively lower Km for TH compared to the other compounds transported by the TH transporters (Table 1) should help TH to compete favourably.
In addition, it is likely that the lower expression of MCT8, MCT10, OATP1A2 and LAT1 before 14 wks compared to term, as well as the nadir in OATP4A1 and CD98 expression in the late 1st and early 2nd trimester, may play a role in the necessary limitation of maternal-fetal TH transfer, particularly around the time of onset of endogenous fetal TH production in the early 2nd trimester [3]. Increased expression of TH transporters in late gestation is consistent with the proposal that there is continued/increased maternal to fetal supply of TH in the 3rd trimester despite increasing fetal TH production [8], [46]. It is also likely that increased expression of these transporters with gestation may also fulfil the increased need for other biological substances for fetal growth and development, such as amino acids. The factors regulating the placental expression of these transporters are unknown. There are suggestions in rodents that the activity of system-L and the expression of MCT8 in non-placental tissues are influenced by thyroid status [47], [48] suggesting that TH may be a regulator of its own transporters. Further studies measuring functional activity of each transporter are required to clarify their respective physiological significance in regulating transplacental TH supply.
We hypothesised that alterations in TH transporter action within IUGR placentae may contribute to both malplacentation and fetal hypothyroxinaemia. In contrast to our previous study based on a significantly smaller series [21], our current report shows that MCT8 mRNA expression was not increased in either early or late 3rd trimester IUGR placentae. However, at the protein level, increased MCT8 expression was still observed in representative samples of early 3rd trimester IUGR placentae compared to AGA controls. Very little is known about the regulation of MCT8 expression and protein stability. Post-translational modulation is likely to be involved and such modifications have been reported in other plasma membrane transporters [49].
Jansson et al. have reported that the transport of large neutral amino acids by system-L is reduced in syncytiotrophoblasts isolated from IUGR placentae [50]. Our mRNA findings have not reflected this observation. Contrary to a their study. on isolated syncytiotrophoblasts, our study assessed gene expression in placental homogenates that comprised many cell types. Post-transcriptional and post-translational regulation of system-L transporters could also be responsible for this difference [51].
In our present study, we reported for the first time that MCT10 mRNA expression is decreased in the early 3rd trimester of pregnancy in human villous placentae affected by severe IUGR compared to gestationally-matched AGA controls. Since MCT10 is widely expressed in villous and extravillous trophoblasts from an early gestational age it is possible that reduced MCT10 expression in early pregnancy could result in decreased local TH supply to trophoblasts thus compromising their proliferation and invasive capacity. However, the reduction in MCT10 expression in IUGR placentae at very early gestation is impossible to confirm since the clinical manifestation of fetal growth restriction as a consequence of malplacentation can only be diagnosed later in pregnancy.
Depending on the relative contributions made by each transporter to maternal-fetal transfer of TH, the combination of possible reduced transport by MCT10 and system-L may not be adequately compensated for by increased MCT8 expression and thus may be a contributory factor to fetal hypothyroxinaemia in IUGR pregnancies.
In summary, our present study demonstrates that a range of TH transporters are present in the human placenta from the 1st trimester. Their coordinated effects may regulate both transplacental TH passage from mother to fetus and the development of the placenta itself through the progress of gestation. Changes in placental TH transporter expression associated with IUGR may be part of the pathophysiology of the condition.
Acknowledgements
We thank Mrs Barbara Innes for performing the immunohistochemistry. The major sources of funding for this study were the Medical Research Council (G0501548 and G0600285 to Dr S-Y Chan and Prof M.D Kilby), Research Committee of the University of Birmingham and Action Medical Research (SP4335 to Prof M.D. Kilby). Dr S-Y Chan is supported by a Clinician Scientist Fellowship awarded by the Health Foundation. The authors declare that there is no conflict of interest.
References
- Maternal thyroid deficiency during pregnancy and subsequent neuropsychological development of the child. N Engl J Med. 1999;341:549–555
- . Maternal hypothyroxinaemia during early pregnancy and subsequent child development: a 3-year follow-up study. Clin Endocrinol. 2003;59:282–288
- . Maternal thyroid hormones early in pregnancy and fetal brain development. Best Pract Res Clin Endocrinol Metab. 2004;18:225–248
- Early expression of thyroid hormone deiodinases and receptors in human fetal cerebral cortex. Brain Res Dev Brain Res. 2002;138:109–116
- . Maternal thyroid hormones and fetal brain development. Curr Opin Endocrinol Diabetes. 2005;12:23–30
- Fetal tissues are exposed to biologically relevant free thyroxine concentrations during early phases of development. J Clin Endocrinol Metab. 2002;87:1768–1777
- Thyroid hormones in tissues from human embryos and fetuses. J Endocrinol Invest. 1991;14:559–568
- . Maternal-fetal transfer of thyroxine in congenital hypothyroidism due to a total organification defect or thyroid agenesis. N Engl J Med. 1989;321:13–16
- . Circulating thyroid hormone concentrations and placental thyroid hormone receptor expression in normal human pregnancy and pregnancy complicated by intrauterine growth restriction (IUGR). J Clin Endocrinol Metab. 1998;83:2964–2971
- The in vitro effects of triiodothyronine on epidermal growth factor-induced trophoblast function. J Clin Endocrinol Metab. 2005;90:1655–1661
- . Thyroid hormone as a biological amplifier of differentiated trophoblast function in early pregnancy. Acta Endocrinol. 1991;125:58–66
- . Effects of 3,5,3′-triiodothyronine on the invasive potential and the expression of integrins and matrix metalloproteinases in cultured early placental extravillous trophoblasts. J Clin Endocrinol Metab. 2004;89:5213–5221
- . Is thyroid inadequacy during gestation a risk factor for adverse pregnancy and developmental outcomes?. Thyroid. 2005;15:60–71
- . Overt and subclinical hypothyroidism complicating pregnancy. Thyroid. 2002;12:63–68
- Subclinical hypothyroidism and pregnancy outcomes. Obstet Gynecol. 2005;105:239–245
- . Thyroid hormone transport in and out of cells. Trends Endocrinol Metab. 2008;19:50–56
- . A novel syndrome combining thyroid and neurological abnormalities is associated with mutations in a monocarboxylate transporter gene. Am J Hum Genet. 2004;74:168–175
- Association between mutations in a thyroid hormone transporter and severe X-linked psychomotor retardation. Lancet. 2004;364:1435–1437
- Allan-Herndon-Dudley syndrome and the monocarboxylate transporter 8 (MCT8) gene. Am J Hum Genet. 2005;77:41–53
- The monocarboxylate transporter 8 linked to human psychomotor retardation is highly expressed in thyroid hormone-sensitive neuron populations. Endocrinology. 2005;146:1701–1706
- Monocarboxylate transporter 8 expression in the human placenta: the effects of severe intrauterine growth restriction. J Endocrinol. 2006;189:465–471
- Reabsorption of neutral amino acids mediated by amino acid transporter LAT2 and TAT1 in the basolateral membrane of proximal tubule. Arch Pharm Res. 2005;28:421–432
- . Semi quantitative expression analysis of MDR3, FIC1, BSEP, OATP-A, OATP-C, OATP-D, OATP-E and NTCP gene transcripts in 1st and 3rd trimester human placenta. Placenta. 2003;24:39–44
- Identification of a membrane protein, LAT-2, that Co-expresses with 4F2 heavy chain, an L-type amino acid transport activity with broad specificity for small and large zwitterionic amino acids. J Biol Chem. 1999;274:19738–19744
- . Role of the system L permease LAT1 in amino acid and iodothyronine transport in placenta. Biochem J. 2001;356:719–725
- Expression of organic anion transporting polypeptide E (OATP-E) in human placenta. Placenta. 2003;24:144–148
- . Pathology of intrauterine growth retardation. Am J Reprod Immunol. 1989;21:132–136
- Neurodevelopmental outcome in children with intrauterine growth retardation: a 3-year follow-up. J Child Neurol. 1999;14:724–727
- . School difficulties in 20-year-olds who were born small for gestational age at term in a regional cohort study. Pediatrics. 2001;108:111–115
- . Thyroid hormone action in the placenta. Placenta. 2005;26:105–113
- . Thyroid function in small for gestational age fetuses. Obstet Gynecol. 1991;77:701–706
- Placental iodothyronine deiodinase expression in normal and growth-restricted human pregnancies. J Clin Endocrinol Metab. 2003;88:4488–4495
- . Punch biopsy of the human placental bed. Am J Obstet Gynecol. 2002;187:1349–1355
- Basolateral aromatic amino acid transporter TAT1 (Slc16a10) functions as an efflux pathway. J Cell Physiol. 2006;206:771–779
- Characterization of two splice variants of human organic anion transporting polypeptide 3A1 isolated from human brain. Am J Physiol Cell Physiol. 2007;292:C795–C806
- Monocarboxylate transporter 8 in neuronal cell growth. Endocrinology. 2009;150:1961–1969
- . Organic anion-transporting polypeptides mediate transport of opioid peptides across blood–brain barrier. J Pharmacol Exp Ther. 2000;294:73–79
- Chlorambucil-taurocholate is transported by bile acid carriers expressed in human hepatocellular carcinomas. Gastroenterology. 1997;113:1295–1305
- . Development and polarization of cationic amino acid transporters and regulators in the human placenta. Am J Physiol Cell Physiol. 2000;278:C1162–C1171
- Expression and regulation of 4F2hc and hLAT1 in human trophoblasts. Am J Physiol Cell Physiol. 2002;282:C196–C204
- . Alanine transport systems in isolated basal plasma membrane of human placenta. Am J Physiol. 1989;256:C630–C637
- l-Serine uptake by human placental microvillous membrane vesicles. Placenta. 2007;28:445–452
- . 3,5,3′-Triiodothyronine down-regulates Fas and Fas ligand expression and suppresses caspase-3 and poly (adenosine 5′-diphosphate-ribose) polymerase cleavage and apoptosis in early placental extravillous trophoblasts in vitro. J Clin Endocrinol Metab. 2004;89:4069–4077
- . Architecture of normal villous trees. In: Pathology of the human placenta. 4th ed. Springer Verlag; 2000;p.116 [Chapter 7]
- Human fetal and cord serum thyroid hormones: developmental trends and interrelationships. J Clin Endocrinol Metab. 2004;89:4097–4103
- . Fetal thyroid function: diagnosis and management of fetal thyroid disorders. Clin Obstet Gynecol. 1997;40:16–31
- . Developmental studies on the uptake of tyrosine by synaptosomes and plasma membrane vesicles derived from rat brain. Effect of thyroid hormones. Int J Dev Neurosci. 1986;4:13–20
- . The monocarboxylate transporter 8 and L-type amino acid transporters 1 and 2 are expressed in mouse skeletons and in osteoblastic MC3T3-E1 cells. Thyroid. 2009;19:171–180
- Low doses of ochratoxin A upregulate the protein expression of organic anion transporters Oat1, Oat2, Oat3 and Oat5 in rat kidney cortex. Toxicol Appl Pharmacol. 2009;239:284–296
- . Placental transport of leucine and lysine is reduced in intrauterine growth restriction. Pediatr Res. 1998;44:532–537
- . Mammalian target of rapamycin in the human placenta regulates leucine transport and is down-regulated in restricted fetal growth. J Physiol. 2007;582:449–459
- . Identification of monocarboxylate transporter 8 as a specific thyroid hormone transporter. J Biol Chem. 2003;278:40128–40135
- The human T-type amino acid transporter-1: characterization, gene organization, and chromosomal location. Genomics. 2002;79:95–103
- . Effective cellular uptake and efflux of thyroid hormone by human monocarboxylate transporter 10. Mol Endocrinol. 2008;22:1357–1369
- Thyroid hormone transport by the heterodimeric human system L amino acid transporter. Endocrinology. 2001;142:4339–4348
- . Cellular entry of thyroid hormones by organic anion transporting polypeptides. Best Pract Res Clin Endocrinol Metab. 2007;21:209–221
- . The superfamily of organic anion transporting polypeptides. Biochim Biophys Acta. 2003;1609:1–18
- Identification of thyroid hormone transporters in humans: different molecules are involved in a tissue-specific manner. Endocrinology. 2001;142:2005–2012
- Organic anion-transporting polypeptide B (OATP-B) and its functional comparison with three other OATPs of human liver. Gastroenterology. 2001;120:525–533
PII: S0143-4004(10)00039-1
doi:10.1016/j.placenta.2010.01.013
© 2010 Elsevier Ltd. All rights reserved.
