Placenta
Volume 31, Issue 9 , Pages 811-817, September 2010

Differential host response to LPS variants in amniochorion and the TLR4/MD-2 system in Macaca nemestrina

  • J. Chang

      Affiliations

    • Department of Obstetrics & Gynecology, Magee Women’s Hospital, Pittsburgh, PA, USA
  • ,
  • S. Jain

      Affiliations

    • Department of Periodontics, University of Washington, Seattle, WA, USA
  • ,
  • D.J. Carl

      Affiliations

    • Ross University School of Medicine, Dominica, West Indies
  • ,
  • L. Paolella

      Affiliations

    • Seattle Children’s Hospital, Seattle, WA, USA
  • ,
  • R.P. Darveau

      Affiliations

    • Department of Periodontics, University of Washington, Seattle, WA, USA
  • ,
  • M.G. Gravett

      Affiliations

    • Department of Obstetrics & Gynecology, University of Washington, Box 356460, Seattle, WA 98195-6460, USA
  • ,
  • K.M. Adams Waldorf

      Affiliations

    • Department of Obstetrics & Gynecology, University of Washington, Box 356460, Seattle, WA 98195-6460, USA
    • Corresponding Author InformationCorresponding author. Tel.: +1 206 543 6712; fax: +1 206 543 3915.

Accepted 16 June 2010. published online 12 July 2010.

Article Outline

Abstract 

Objectives

Microbial-specific factors are likely critical in determining whether bacteria trigger preterm labor. Structural variations in lipopolysaccharide (LPS), a component of gram-negative bacteria, can determine whether LPS has an inflammatory (agonist) or anti-inflammatory (antagonist) effect through Toll-like receptor 4 (TLR4). Our objective was to determine whether amniochorion could discriminate between LPS variants in a nonhuman primate model. We also cloned Macaca nemestrina TLR4 and MD-2 and compared this complex functionally to the human homologue to establish whether nonhuman primates could be used to study TLR4 signaling in preterm birth.

Study design

Amniochorion explants from M. nemestrina were stimulated with a panel of LPS variants for 24 h. Supernatants were analyzed for IL-1β, TNF-α, IL-6, IL-8 and prostaglandins E2 and F2α. Tissue expression of TLR1, 2, 4, 6, MyD88 and NF-kB was studied by RT-PCR. M. nemestrina TLR4 and MD-2 genes were cloned and compared with their human counterparts in a recombinant TLR4 signaling system to determine LPS sensitivity.

Results

LPS variants differentially stimulated cytokines and prostaglandins, which was not related to transcriptional changes of TLR4 or other TLRs. Nearly all elements of LPS binding and TLR4 leucine-rich repeats were conserved between humans and M. nemestrina. TLR4/MD-2 signaling complexes from both species were equally sensitive to LPS variants.

Conclusions

LPS variants elicit a hierarchical inflammatory response within amniochorion that may contribute to preterm birth. LPS sensitivity is similar between M. nemestrina and humans, validating M. nemestrina as an appropriate model to study TLR4 signaling in preterm birth.

Keywords: Amniochorion, LPS, TLR4, TLR4 antagonist, Macaca nemestrina, Nonhuman primate

 

Back to Article Outline

1. Introduction 

Preterm birth, defined as birth before 37 completed weeks of gestation, remains a major challenge in obstetrics and is the most important direct cause of neonatal mortality [1]. Prematurity complicates 1 in 8 pregnancies with an annual economic burden of 26 billion dollars [2]. A large body of evidence suggests that up to 50% of very premature births (less than 30 weeks gestation) are caused by intrauterine infections [3]. Premature births have recently been associated with other infections such as periodontitis, a common bacterial infection of the dental periosteum characterized by a localized, chronic inflammatory response. Bacteria associated with periodontitis may also enter the bloodstream and infect the placenta [4], [5], [6]. However, the magnitude of the association between periodontitis and premature delivery is modest (odds ratios 2–3) and inconsistent. Further, randomized treatment trials of periodontitis in pregnancy have not consistently demonstrated reductions in preterm birth [7], [8], [9].

Lack of a consistent association between periodontitis and premature birth may be due to differences in bacterial pathogenicity. More than 300 bacterial species have been isolated from the oral cavity [10], [11]. Principally, three gram-negative species, Porphyromonas gingivalis, Tannerella forsythia, and Treponema denticola, have been associated with chronic periodontitis. Local and systemic inflammatory responses to these bacteria are modulated by differences in bacterial species and lipopolysaccharide (LPS) [12]. The bioactive component of LPS, lipid A, is recognized by the Toll-like 4 receptor (TLR4), which triggers an innate immune response through NF-κB activation and cytokine gene transcription. While the response to the prototypical LPS structure (e.g. Escherichia coli) is very potent, LPS structural variants have been reported for many bacteria, including P. gingivalis, for which the innate immune response is weak [13], [14]. In addition, P. gingivalis is capable of synthesizing different LPS structures, in response to environmental conditions, which have differing abilities to weakly activate or antagonize TLR4 [15]. Modification of LPS represents a survival strategy that allows the bacterium to evade host immunity, replicate, and invade further into the host [16], [17], [18].

TLR4 is strongly expressed by the fetal membranes and its activation is critical for LPS-induced preterm birth [19], [20]. We hypothesized that amniochorion can mount variable degrees of inflammation in response to the strength of TLR4 signaling. Since there is a link between periodontitis and preterm birth we decided to test LPS variants of P. gingivalis, a bacterium strongly implicated in periodontitis. These P. gingivalis LPS structural variants have been previously well characterized both structurally and functionally. In a nonhuman primate (Macaca nemestrina) model, we used an amniochorion explant system to test the ability of fetal membranes to discriminate between LPS variants that differentially activate TLR4. We also cloned M. nemestrina TLR4 and MD-2 and compared this complex functionally to the human homologue to establish our explant system as a model for studying TLR4 signaling in preterm birth.

Back to Article Outline

2. Materials and methods 

2.1. LPS structural variants 

LPS variants from E. coli K-12 strain JM83 and P. gingivalis have been previously isolated, purified, and characterized (Fig. 1) [14], [15], [21]. The lipid A structures have been elucidated by matrix-assisted laser desorption time-of-flight (MALDI-TOF) mass spectrometry [14], [22]. The strong TLR4 agonist was an E. coli-derived LPS (EcLPS). The weak TLR4 agonist was produced by P. gingivalis grown under low haemin conditions (PgLPSweak) [14], [23]. We used two TLR4 antagonists. The first was an E. coli mutant with an altered LPS which down-regulates the host response to LPS (LPSmsbB) [24]. The second was derived from P. gingivalis grown under high haemin conditions (PgLPSantag) [15], [25].

  • View full-size image.
  • Fig. 1 

    Structures of LPS variants. PgLPSweak and PgLPSantag were isolated from P. gingivalis grown under low and high haemin conditions, respectively. The structures have been elucidated using MALDI-TOF mass spectrometry. PgLPSweak and PgLPSantag are a mixture of predominantly two LPS variants as shown.

2.2. Amniochorion explant system and LPS stimulation 

Pregnant M. nemestrina (n = 6) underwent cesarean section at term prior to the onset of labor. Amniochorion from these placentas were cleared of decidua and blood using gauze and washed in Hank’s Balanced Salt Solution. A single 6 mm amniochorion punch biopsy was placed in each cell culture insert within a 24-well tissue culture plate (Falcon). The explants were cultured in Dulbecco’s modified Eagle’s medium Ham’s F12 nutrient mixture (1:1) with 15% heat-inactivated fetal bovine serum, penicillin (100 U/ml), streptomycin (100 U/ml) and Amphotericin B (0.025 ug/ml) for 48 h at 37 °C in 5% CO2; culture media and room air was changed daily. The explants were cultured for 48 h prior to initiation of the experiment to allow for a return to baseline of inflammatory mediators stimulated by the physical manipulation of tissue during initial preparation[26]. Light microscopy was performed daily to inspect each well for bacterial contamination. After 48 h, each explant was treated for 24 h with culture medium (control) or 10 ng/ml of EcLPS, LPSmsbB, LPSweak, or LPSantag. At 24 h, supernatants from each well were collected and stored at −80 °C until processing. Explants were then placed in RNAlater (Qiagen, Valencia, CA) and incubated at 4 °C prior to storing at −80 °C.

2.3. Quantitation of cytokines and prostaglandins 

Supernatants were tested for IL-1β, TNF-α, IL-6 and IL-8 using a nonhuman primate cytokine multiplex immunoassay (Millipore, Billerica, MA) with Luminex technology (Luminex Corp, Austin, TX). Supernatants were also assayed for PGE2 and PGF2α using commercially available ELISA kits (Cayman Chemical, Ann Arbor, MI) known to cross-react with M. nemestrina antigens.

2.4. RNA extraction and quantitative real-time PCR (qRT-PCR) 

RNA extractions were performed using a standard TRIzol (Invitrogen, Carlsbad, CA, USA) method and concentrations ascertained using a NanoDrop-1000 (Thermo Scientific, Waltham, MA, USA). RNA integrity was determined using an Agilent 2100 Bioanalyzer (Agilent, Santa Clara, CA, USA). Complementary DNAs (cDNA) were made with SuperScript III First-Strand Synthesis System (Invitrogen Inc., Carlsbad, CA) following the manufacturer’s protocol for random hexamers.

Primers and probes to quantitate gene expression of TLR1 (Rh02787277_s1), TLR2 (Rh02787279_s1), TLR3 (Rh02845008_m1), TLR4 (Rh01564846_m1), TLR6 (Rh00414981_m1), and 18S rRNA (Rh00414981_m1) were ordered through Applied Biosystem’s Assay-on-Demand (Applied Biosystems Inc.). MyD88 and NF-κB cDNA primers and probes were designed based on published sequences for Macaca mulatta with the following sequences: MyD88 – FWD: 5′CCTGCAGAGCAAGGAATGTGA3′, REV: 5′ACCTGGAGAGAGGCTGAGT3′, 5′-FAM-TTCCAGACCAAATTTG-NFQ-3′. NF-κB – FWD: 5′CACGTGGCCGCTACCTA3′, REV: 5′GGACCCCGGAGTTAAGCA3′, 5′-FAM-CTCCCAGGAGTTCTC-NFQ-3′. For all genes, probes were labeled with [6-carboxy-fluorescein] and a Nonfluorescent Quencher (NFQ).

qRT-PCR was performed on ABI PRISM 7900HT system (Applied Biosystems Inc., Foster City, CA, USA) using the FAST system in a 12 ul reaction consisting of 20 ng cDNA, 0.5X TaqMan Gene Expression Fast Universal Master Mix (Applied Biosystems Inc.), and 0.5X Assay Mix (Applied Biosystems Inc.). The reaction profile consisted of denaturing at 95 °C for 15 s followed by 40 cycles of 95 °C for 1 s and 60 °C for 20 s. Data analysis was completed using the Sequence Detection Systems V2.2.2 software (Applied Biosystems Inc).

2.5. Cloning of M. Nemestrina TLR4 and MD-2 

M. nemestrina genes encoding TLR4 and MD-2 were cloned from RNA isolated from peripheral blood mononuclear cells (PBMC). PBMC were extracted from M. nemestrina whole blood by Ficoll Hypaque (Pharmacia Biotech, Uppsala, Sweden) gradient centrifugation (1.077 g/ml density). RNA was isolated from 106 cells using RNeasy (Qiagen). Since the M. nemestrina genome has not been sequenced, primers were designed using the sequenced and annotated genome of M. mulatta, the closest sequenced relative. Using M. mulatta as the reference strain, primers (Table 1) were designed to amplify M. nemestrina tlr4 and md-2 genes by RT-PCR using extracted RNA as the template. Both tlr4 and md-2 genes were amplified and sequenced twice from independently isolated RNA samples. The md-2 gene was amplified using primers SJ110 and SJ123, digested with NheI and PmlI, and cloned into the NheI and EcoRV sites of the plasmid vector pcDNA3.1-, generating the plasmid pSJ96. The tlr4 gene was amplified in three fragments utilizing the internal EcoRI and HinDIII sites. The first fragment was amplified using primers SJ116 and SJ113, digested with NheI and EcoRI, and cloned into the NheI and EcoRI sites of pcDNA3.1-. The middle fragment was added as an EcoRI-HinDIII fragment and amplified using primers SJ112 and SJ115. The last piece was added on a HinDIII-PmeI fragment and amplified using primers SJ114 and SJ117. The final plasmid, pSJ90, contained the full length M. nemestrina tlr4 gene. Sequence data have been submitted to the GenBank database under accession numbers GU969614 (tlr4) and GU969615 (md-2).

Table 1. Primers used to amplify M. nemestrina md-2 and tlr4 genes. Restriction sites are shown in lower case.
Primer nameSequenceRestriction site
SJ110TCAgctagcCTGCTTACTGAAAAGGAAGAGTCTGNheI
SJ112GGGATTGTGCAATTTGACCATTGAAgaattcCGAEcoRI
SJ113TCGgaattcTTCAATGGTCAAATTGCACAATCCCEcoRI
SJ114CAGCATTTGACACACTCAACaagcttCAGGTACHinDIII
SJ115GTACCTGaagcttGTTGAGTGTGTCAAATGCTGHinDIII
SJ116AAgctagcGGATGATGCCAGGATGACGTCTGCNheI
SJ117ATgtttaaaCTGGGCAAGAAATGCCTCAGGAGTPmeI
SJ123ATcacgtgCTCAATTTATTCTAATTTGAATTAGGTTGGTGTATGATGPmlI

2.6. Recombinant TLR4 signaling system 

Human embryonic kidney cells (HEK293) were transfected with plasmids encoding either M. nemestrina or human TLR4 and MD-2. These cells were also transfected with reporter plasmids pNF-κB-TA-luciferase and pβ-actin-Renilla-luciferase which are part of the dual luciferase assay system used to measure transcription of a reporter plasmid by NF-κB, a transcription factor activated by LPS stimulation of TLR4 [25].

HEK293 was maintained in Dulbecco’s Modified Eagle Medium (Invitrogen Life Technologies) and supplemented with 10% heat-inactivated Fetal Bovine Serum (HyClone), penicillin (100 U/ml) and streptomycin (100 ug/ml). HEK293 cells were plated in 96-well plates at a density of 4 × 104 cells/well and transfected the following day by a standard calcium phosphate precipitation method. The amounts of plasmids transfected were as follows: pNF-κB-TA-Luc (2 ng), pβ-actin-Renilla-Luc (0.3 ng), pTLR4 (2 ng), and pMD-2 (2.5 ng). The empty expression vector, pDisplay, was used to adjust the total amount of DNA transfected per well up to 0.1 ug. After 24 h, the transfected cells were stimulated in triplicate for 4 h with LPS. Stimulation medium contained 10% human serum, which is rich in soluble CD14 required for LPS transfer to TLR4/MD-2. After stimulation, the cells were lysed with 50 ul of passive lysis buffer (Promega). Luciferase activity of 10 ul of each lysate was measured using the Dual Luciferase Assay Reporter System (Promega). Data are expressed as the ratio of NF-κB-dependent firefly luciferase activity to the constitutive β-actin promoter-dependent Renilla-luciferase activity. Fold-increase of the above ratio from LPS-stimulated samples was compared to unstimulated samples.

2.7. Statistical analysis 

Data were log-transformed and then analyzed using ANOVA with a Bonferroni correction for multiple comparisons using Intercooled STATA 9.0 (StataCorp LP, College Station, Texas). Comparisons between experimental conditions in the explant model were between explants cultured in LPS or media (control) for 24 h after the initial 48 h in culture. To compare human and M. nemestrina activation of the reporter assay in the recombinant TLR4 signaling system, a Wilcoxon rank sum test with Bonferroni correction was performed used Intercooled STATA 9.0.

Back to Article Outline

3. Results 

3.1. A strong TLR4 agonist is necessary to stimulate cytokine and prostaglandin synthesis in fetal membranes 

To determine if LPS variants elicit a hierarchical inflammatory response in fetal membranes from a nonhuman primate, we used an amniochorion explant system from term M. nemestrina (N = 6) [26], [27]. Unstimulated membranes secreted low or undetectable levels of all cytokines and prostaglandins tested (Fig. 2). Compared to controls, EcLPS induced significantly higher levels of TNF-α, IL-6, and IL-8 (all p < 0.01); IL-1β levels were elevated, but not significantly (p = 0.05). EcLPS stimulated significantly higher levels of TNF-α than the weak TLR4 agonist (PgLPSweak) or TLR4 antagonists (LPSmsbB, PgLPSantag; all p < 0.01). Levels of cytokines stimulated with TLR4 antagonists or weak agonist were generally similar to unstimulated controls, except in the case of LPSmsbB which induced higher IL-8 than present in controls (p < 0.05).

  • View full-size image.
  • Fig. 2 

    Luminex and ELISA analysis of cytokines and prostaglandins in amniochorion explant supernatant 24-h after LPS stimulation. Values are means ± SEMs of N = 6 independent experiments. Values were log-transformed and analyzed using ANOVA with a Bonferroni correction applied to pairwise comparisons.

EcLPS induced significantly greater levels of PGE2 (p < 0.05) and PGF2α (p < 0.01) compared to controls (Fig. 2). EcLPS also induced higher PGE2 compared to PgLPSweak (p < 0.05). In comparison to all other LPS variants, EcLPS stimulated the greatest levels of PGF2α (p < 0.05 for LPSmsbB, PgLPSantag; p < 0.01 for PgLPSweak). PGE2 and PGF2α levels were similar after stimulation by culture media alone, a weak TLR4 agonist, or TLR4 antagonists.

3.2. LPS structural variants do not upregulate TLR4 mRNA in amniochorion 

The effect of differential TLR4 signaling on transcription of several TLRs (TLR1, 2, 4, 6) and mediators of TLR4 signaling (MyD88, NF-κB) was evaluated using quantitative reverse transcriptase–polymerase chain reaction assays after 24 h of LPS stimulation (Fig. 3). TLR4 mRNA was not altered in response to any LPS variant and levels remained similar to unstimulated controls. Although no comparisons were statistically significant, slightly higher TLR2 mRNA levels were found under all experimental conditions. Compared to the unstimulated control, TLR2 mRNA was increased 2.4-fold after stimulation with EcLPS.

  • View full-size image.
  • Fig. 3 

    Quantitative RT-PCR analysis of gene expression in amniochorion explants 24-h after LPS stimulation. Values are means ± SEMs of N = 6 independent experiments. Analysis by ANOVA with a Bonferroni correction yielded no significant differences.

3.3. M. nemestrina and human TLR4 and MD-2 are structurally similar with a nearly identical dimerization interface 

In order to determine whether the M. nemestrina TLR4 and co-receptor MD-2, is functionally similar to that of human, we cloned them from the RNA of M. nemestrina peripheral blood. Sequence analysis revealed that the M. nemestrina tlr4 cDNA is 2481 base pairs (bp) and, at the protein level, differs in only six amino acids (aa) from the M. mulatta TLR4 (99.3% identical; Supplementary Figs. 1 and 2). The human tlr4 cDNA is 2520 bp with an extra 13 aa at the carboxy-terminus of the protein. Over the aligned portions of 826 aa, M. nemestrina TLR4 differs from the human TLR4 at 48 aa residues (92.6% identical, 95.4% similar). The MD-2 protein sequence between M. nemestrina and M. mulatta is identical and both differ from human MD-2 by 11 aa residues scattered over the 160 aa protein (93.2% identical, 96.9% similar).

We further analyzed whether differences in aa residues might affect the TLR4-MD-2-LPS dimerization interface as recently revealed by the crystal structure of the human complex [28]. All TLR4 residues important for hydrophobic interactions (F440, L444, and F463) and charge interactions with LPS phosphates (K388, R264, K341, K362) are conserved. Three of the four TLR4 aa residues important for hydrogen bonding between TLR4 and MD-2 are identical (S416, N417, Q436) in M. nemestrina and human; only a single residue changed from glutamic acid (E439) to glutamine. The leucine-rich repeat modules in the main TLR4 dimerization interface (15–17) are also identical in human and M. nemestrina [29]. The MD-2 residues important for hydrophobic interactions (F126, I124, L87, M85, V82) and hydrogen bonding (G123, K125, R90) are conserved between human and M. nemestrina; for the residues involved in charge interactions with phosphates, two are conserved (S118, K122) and a third is a conservative change (K58R). These results suggest that the M. nemestrina TLR4-MD-2-LPS complex has a nearly identical protein structure to that of the human in the regions critical for dimerization.

3.4. LPS stimulation of M. nemestrina and human TLR4 recombinant signaling system 

To compare human and M. nemestrina TLR4 activation in response to E. coli and multiple LPS variants, we used a recombinant TLR4 signaling system that has previously been established [25]. In HEK293 cells transfected with either M. nemestrina or human TLR4 and MD-2 encoding plasmids, NF-κB expression was strikingly similar between the two species for all LPS variants tested (Fig. 4). There were no significant differences in activation of the reporter assay between human and M. nemestrina. This suggests that the TLR4/MD-2 signaling complex in both species has a comparable capacity to respond to different LPS structures.

  • View full-size image.
  • Fig. 4 

    Recombinant TLR4 signaling system to compare human and M. nemestrina TLR4 activation in HEK293 cells. Data are expressed as the fold-increase in relative light units (which represents the ratio of NF-κB-luciferase to β-actin Renilla-luciferase expression) relative to that of a no-stimulation control. There were no significant differences between human and M. nemestrina activation of the reporter assay by Wilcoxon rank sum with Bonferroni correction.

Back to Article Outline

4. Discussion 

Many gram-negative bacteria, like P. gingivalis, can alter their LPS structures to modulate the host immune response, which may represent an important bacterial-specific virulence factor allowing invasion of the amniotic cavity and preterm labor. Our study objective was to determine whether LPS variants induced differential TLR4 signaling in macaque amniochorion and whether LPS sensitivity of human and M. nemestrina TLR4-MD-2 complex was similar. Overall, LPS induced a hierarchical inflammatory response that correlated with TLR4 activation. The strong TLR4 agonist elicited significantly higher levels of pro-inflammatory cytokines and prostaglandins than LPS variants known to be weak agonists or antagonists. These data suggest that LPS-induced inflammation in amniochorion requires a certain threshold of TLR4 signaling, which is determined by LPS structure. This requirement may play a role in determining whether an infection will elicit a robust response leading to rapid preterm birth or whether the host response can be evaded allowing for the development of a chronic infection leading to preterm birth after several weeks.

Comparable cytokine and prostaglandin responses for the weak TLR4 agonist and antagonists were expected, because a classic TLR4 antagonist is also a weak agonist. Prior comparison of gene activation profiles for the weak TLR4 agonist and TLR4 antagonists revealed few differences in human umbilical vein epithelial cells [30]. The modest elevations in IL-6 and IL-8 induced by the TLR4 antagonists and weak TLR4 agonist may have been due to TLR2 activation. Although synthetically made P. gingivalis lipid A does not activate TLR2, a complete LPS molecule may activate TLR2 in a region distinct from lipid A [31], [32]. Alternatively, a contaminant from LPS extraction may activate TLR2.

The lack of transcriptional regulation of TLR4 in amniochorion is consistent with studies in other tissues [33], [34]. Previous studies in an ex vivo model of human amniotic epithelium demonstrated TLR4 translocation from the apical surface to the basal membrane after LPS stimulation, which may represent one mechanism of posttranscriptional control [35]. TLR2 mRNA levels, however, were elevated in a pattern consistent with degree of TLR4 activation. In vitro studies using endothelial cells and murine alveolar macrophages also demonstrated TLR2 upregulation in response to LPS stimulation [36], [37]. Whether this is due to TLR4 or TLR2 activation is unknown, but this finding suggests that activation of one TLR may alter amniochorion responsiveness of other TLR against future pathogens.

To our knowledge, this is the first time TLR4 and MD-2 from M. nemestrina have been cloned and LPS responsiveness characterized. The 95% similarity between human and M. nemestrina TLR4 proteins may be compared with 79% similarity with mouse and 64% with chicken TLR4 [38], [39]. We have demonstrated that regions critical for LPS-TLR4 dimerization are essentially conserved; we would thus expect M. nemestrina TLR4/MD-2 to have a similar sensitivity to LPS as in the human homologues, which we have shown in a recombinant system. In this system, activation of NF-κB by the weak agonist and antagonists was expected, because the system is designed to sensitively detect TLR4 activation; yet, in host cells, little cytokine transcription is observed accounting for the ability of antagonists and weak agonists to block stronger agonists. Cloning and functional characterization of a nonhuman primate TLR4/MD-2 with similar LPS sensitivity to humans is important because species-specific differences in how the TLR4-MD-2 receptor complex recognizes variations in lipid A structures exist. For example, tetra- and penta-acylated LPS act as TLR4 antagonists or weak agonists in human cells, but as agonists in a murine system [40], [41]. We found similar sensitivity of the human and M. nemestrina TLR4-MD-2 system to lipid A structures that are mostly hexa- (EcLPS), penta- (PgLPSweak) and tetra-acylated (PgLPSantag, LPSmsbB).

Currently, there are limited interventions to prevent preterm birth associated with infection. Microbial factors important in the pathogenesis of an ascending infection into the amniotic cavity are not well understood. Animal models have depended upon species in which the regulation of labor differs significantly from humans or upon expensive and relatively limited nonhuman primate models [42]. Altering LPS structure in order to antagonize TLR4 and downregulate the innate immune response has been proposed to account for the progression of periodontitis, bacterial survival and tissue invasion. Whether this mechanism could also dampen the placental immune response, promote bacterial survival and invasion of the amniotic cavity is unknown, but is supported by our prior work in a nonhuman primate model using a TLR4 antagonist to inhibit LPS-induced increases in pro-inflammatory cytokines and prostaglandins in amniotic fluid [19]. In addition to P. gingivalis, many other bacteria can modify LPS structures to evade host immunity [17], [43], [44]; key bacteria implicated in preterm birth have yet to be studied. Our results suggest that M. nemestrina has a TLR4-MD-2 receptor complex that differentially recognizes a variety of lipid A structures in a manner similar to humans. The monkey amniochorion explant model may allow investigation of TLR4 signaling and help identify potential intervention strategies to refine and limit whole animal experimentation.

Back to Article Outline

Acknowledgments 

We sincerely thank Jan Hamanishi for technical assistance with the figures and Dr. Marie-Térèse Little for manuscript editing.

Supported by NIH grant AI067910, T32 DE07132-25, March of Dimes, and the Washington State Obstetrical Association.

Back to Article Outline

Appendix. Supplementary data 

Back to Article Outline

References 

  1. Lawn JE, Wilczynska-Ketende K, Cousens SN. Estimating the causes of 4 million neonatal deaths in the year 2000. Int J Epidemiol. 2006;35:706–718
  2. In:  Behrman RE,  Stith Butler A editor. Preterm birth: causes, consequences, and prevention. Washington, D.C.: National Academies Press; 2006;
  3. Goldenberg RL, Hauth JC, Andrews WW. Intrauterine infection and preterm delivery. N Engl J Med. 2000;342:1500–1507
  4. Vergnes JN, Sixou M. Preterm low birth weight and maternal periodontal status: a meta-analysis. Am J Obstet Gynecol. 2007;196(135):e131–e137
  5. Han YW, Ikegami A, Bissada NF, Herbst M, Redline RW, Ashmead GG. Transmission of an uncultivated Bergeyella strain from the oral cavity to amniotic fluid in a case of preterm birth. J Clin Microbiol. 2006;44:1475–1483
  6. Han YW, Redline RW, Li M, Yin L, Hill GB, McCormick TS. Fusobacterium nucleatum induces premature and term stillbirths in pregnant mice: implication of oral bacteria in preterm birth. Infect Immun. 2004;72:2272–2279
  7. Michalowicz BS, Hodges JS, DiAngelis AJ, Lupo VR, Novak MJ, Ferguson JE, et al. Treatment of periodontal disease and the risk of preterm birth. N Engl J Med. 2006;355:1885–1894
  8. Offenbacher S, Beck JD, Jared HL, Mauriello SM, Mendoza LC, Couper DJ, et al. Effects of periodontal therapy on rate of preterm delivery: a randomized controlled trial. Obstet Gynecol. 2009;114:551–559
  9. Polyzos NP, Polyzos IP, Mauri D, Tzioras S, Tsappi M, Cortinovis I, et al. Effect of periodontal disease treatment during pregnancy on preterm birth incidence: a metaanalysis of randomized trials. Am J Obstet Gynecol. 2009;200:225–232
  10. Moore WE, Moore LV. The bacteria of periodontal diseases. Periodontol. 2000;1994(5):66–77
  11. Socransky SS, Haffajee AD, Dzink JL. Relationship of subgingival microbial complexes to clinical features at the sampled sites. J Clin Periodontol. 1988;15:440–444
  12. Darveau RP, Tanner A, Page RC. The microbial challenge in periodontitis. Periodontol. 2000;1997(14):12–32
  13. Reife RA, Shapiro RA, Bamber BA, Berry KK, Mick GE, Darveau RP. Porphyromonas gingivalis lipopolysaccharide is poorly recognized by molecular components of innate host defense in a mouse model of early inflammation. Infect Immun. 1995;63:4686–4694
  14. Coats SR, Jones JW, Do CT, Braham PH, Bainbridge BW, To TT, et al. Human Toll-like receptor 4 responses to P. gingivalis are regulated by lipid A 1- and 4′-phosphatase activities. Cell Microbiol. 2009;
  15. Al-Qutub MN, Braham PH, Karimi-Naser LM, Liu X, Genco CA, Darveau RP. Hemin-dependent modulation of the lipid A structure of Porphyromonas gingivalis lipopolysaccharide. Infect Immun. 2006;74:4474–4485
  16. Marsh PD, McDermid AS, McKee AS, Baskerville A. The effect of growth rate and haemin on the virulence and proteolytic activity of Porphyromonas gingivalis W50. Microbiology. 1994;140(Pt 4):861–865
  17. Darveau RP, Charnetzky WT, Hurlbert RF, Hancock RE. Effects of growth temperature, 47-megadalton plasmid, and calcium deficiency on the outer membrane protein porin and lipopolysaccharide composition of Yersinia pestis EV76. Infect Immun. 1983;42:1092–1101
  18. Guo L, Lim KB, Gunn JS, Bainbridge B, Darveau RP, Hackett M, et al. Regulation of lipid A modifications by Salmonella typhimurium virulence genes phoP-phoQ. Science. 1997;276:250–253
  19. Adams Waldorf KM, Persing D, Novy MJ, Sadowsky DW, Gravett MG. Pretreatment with Toll-like receptor 4 antagonist inhibits lipopolysaccharide-induced preterm uterine contractility, cytokines, and prostaglandins in rhesus monkeys. Reprod Sci. 2008;15:121–127
  20. Elovitz MA, Wang Z, Chien EK, Rychlik DF, Phillippe M. A new model for inflammation-induced preterm birth: the role of platelet-activating factor and Toll-like receptor-4. Am J Pathol. 2003;163:2103–2111
  21. Bainbridge BW, Coats SR, Pham TT, Reife RA, Darveau RP. Expression of a Porphyromonas gingivalis lipid A palmitylacyltransferase in Escherichia coli yields a chimeric lipid A with altered ability to stimulate interleukin-8 secretion. Cell Microbiol. 2006;8:120–129
  22. Kumada H, Haishima Y, Umemoto T, Tanamoto K. Structural study on the free lipid A isolated from lipopolysaccharide of Porphyromonas gingivalis. J Bacteriol. 1995;177:2098–2106
  23. Reife RA, Coats SR, Al-Qutub M, Dixon DM, Braham PA, Billharz RJ, et al. Porphyromonas gingivalis lipopolysaccharide lipid A heterogeneity: differential activities of tetra- and penta-acylated lipid A structures on E-selectin expression and TLR4 recognition. Cell Microbiol. 2006;8:857–868
  24. Somerville JE, Cassiano L, Bainbridge B, Cunningham MD, Darveau RP. A novel Escherichia coli lipid A mutant that produces an antiinflammatory lipopolysaccharide. J Clin Invest. 1996;97:359–365
  25. Coats SR, Pham TT, Bainbridge BW, Reife RA, Darveau RP. MD-2 mediates the ability of tetra-acylated and penta-acylated lipopolysaccharides to antagonize Escherichia coli lipopolysaccharide at the TLR4 signaling complex. J Immunol. 2005;175:4490–4498
  26. Fortunato SJ, Menon R, Swan KF, Lyden TW. Organ culture of amniochorionic membrane in vitro. Am J Reprod Immunol. 1994;32:184–187
  27. Menon R, Peltier MR, Eckardt J, Fortunato SJ. Diversity in cytokine response to bacteria associated with preterm birth by fetal membranes. Am J Obstet Gynecol. 2009;201(306):e301–306
  28. Park BS, Song DH, Kim HM, Choi BS, Lee H, Lee JO. The structural basis of lipopolysaccharide recognition by the TLR4-MD-2 complex. Nature. 2009;458:1191–1195
  29. Matsushima N, Tanaka T, Enkhbayar P, Mikami T, Taga M, Yamada K, et al. Comparative sequence analysis of leucine-rich repeats (LRRs) within vertebrate Toll-like receptors. BMC Genomics. 2007;8:124
  30. Chen C, Coats SR, Bumgarner RE, Darveau RP. Hierarchical gene expression profiles of HUVEC stimulated by different lipid A structures obtained from Porphyromonas gingivalis and Escherichia coli. Cell Microbiol. 2007;9:1028–1038
  31. Kumada H, Haishima Y, Watanabe K, Hasegawa C, Tsuchiya T, Tanamoto K, et al. Biological properties of the native and synthetic lipid A of Porphyromonas gingivalis lipopolysaccharide. Oral Microbiol Immunol. 2008;23:60–69
  32. Sawada N, Ogawa T, Asai Y, Makimura Y, Sugiyama A. Toll-like receptor 4-dependent recognition of structurally different forms of chemically synthesized lipid As of Porphyromonas gingivalis. Clin Exp Immunol. 2007;148:529–536
  33. Nhu QM, Cuesta N, Vogel SN. Transcriptional regulation of lipopolysaccharide (LPS)-induced Toll-like receptor (TLR) expression in murine macrophages: role of interferon regulatory factors 1 (IRF-1) and 2 (IRF-2). J Endotoxin Res. 2006;12:285–295
  34. Fan J, Kapus A, Marsden PA, Li YH, Oreopoulos G, Marshall JC, et al. Regulation of Toll-like receptor 4 expression in the lung following hemorrhagic shock and lipopolysaccharide. J Immunol. 2002;168:5252–5259
  35. Adams KM, Lucas J, Kapur RP, Stevens AM. LPS induces translocation of TLR4 in amniotic epithelium. Placenta. 2007;28:477–481
  36. Satta N, Kruithof EK, Reber G, de Moerloose P. Induction of TLR2 expression by inflammatory stimuli is required for endothelial cell responses to lipopeptides. Mol Immunol. 2008;46:145–157
  37. Oshikawa K, Sugiyama Y. Regulation of Toll-like receptor 2 and 4 gene expression in murine alveolar macrophages. Exp Lung Res. 2003;29:401–412
  38. Qureshi ST, Lariviere L, Leveque G, Clermont S, Moore KJ, Gros P, et al. Endotoxin-tolerant mice have mutations in Toll-like receptor 4 (Tlr4). J Exp Med. 1999;189:615–625
  39. Leveque G, Forgetta V, Morroll S, Smith AL, Bumstead N, Barrow P, et al. Allelic variation in TLR4 is linked to susceptibility to Salmonella enterica serovar Typhimurium infection in chickens. Infect Immun. 2003;71:1116–1124
  40. Rallabhandi P, Awomoyi A, Thomas KE, Phalipon A, Fujimoto Y, Fukase K, et al. Differential activation of human TLR4 by Escherichia coli and Shigella flexneri 2a lipopolysaccharide: combined effects of lipid A acylation state and TLR4 polymorphisms on signaling. J Immunol. 2008;180:1139–1147
  41. Saitoh S, Akashi S, Yamada T, Tanimura N, Kobayashi M, Konno K, et al. Lipid A antagonist, lipid IVa, is distinct from lipid A in interaction with Toll-like receptor 4 (TLR4)-MD-2 and ligand-induced TLR4 oligomerization. Int Immunol. 2004;16:961–969
  42. Elovitz MA, Mrinalini C. Animal models of preterm birth. Trends Endocrinol Metab. 2004;15:479–487
  43. Lepper PM, Triantafilou M, Schumann C, Schneider EM, Triantafilou K. Lipopolysaccharides from Helicobacter pylori can act as antagonists for Toll-like receptor 4. Cell Microbiol. 2005;7:519–528
  44. Triantafilou M, Gamper FG, Lepper PM, Mouratis MA, Schumann C, Harokopakis E, et al. Lipopolysaccharides from atherosclerosis-associated bacteria antagonize TLR4, induce formation of TLR2/1/CD36 complexes in lipid rafts and trigger TLR2-induced inflammatory responses in human vascular endothelial cells. Cell Microbiol. 2007;9:2030–2039

PII: S0143-4004(10)00240-7

doi:10.1016/j.placenta.2010.06.010

Placenta
Volume 31, Issue 9 , Pages 811-817, September 2010