Effect of glucocorticoids on regulation of placental multidrug resistance phosphoglycoprotein (P-gp) in the mouse
Article Outline
- Abstract
- 1. Introduction
- 2. Materials and methods
- 3. Results
- 4. Discussion
- Acknowledgements
- References
- Copyright
Abstract
Previously, we and others have shown that placental Abcb1 mRNA and phosphoglycoprotein (P-gp; encoded by Abcb1 mRNA) decreases over the second half of gestation, resulting in increased accumulation of P-gp substrates in the fetal compartment. Very little is known pertaining to the regulation of placental Abcb1 mRNA and P-gp. In non-placental adult murine tissues, synthetic glucocorticoids have been shown to regulate Abcb1 (Abcb1a and Abcb1b) mRNA in an isoform and tissue-specific manner. Furthermore, given that maternal and fetal endogenous glucocorticoid levels increase dramatically in late gestation, we hypothesized that synthetic glucocorticoids down-regulate placental Abcb1 and P-gp expression, consequently decreasing placental P-gp mediated fetal protection. Pregnant FVB mice were treated with dexamethasone (0.1 mg/kg or 1 mg/kg; s.c.) or vehicle (saline) from either embryonic day (E)9.5–15.5 or E12.5–E18.5 and then injected with [3H]digoxin (i.v.) to assess placental P-gp function. Dexamethasone treatment from E12.5–E18.5 significantly up-regulated Abcb1a mRNA (1 mg/kg) and P-gp (0.1 mg/kg and 1 mg/kg) expression on E18.5; however, this did not correlate to changes in drug accumulation in the fetal compartment. Similarly, dexamethasone (1 mg/kg) treatment during mid-gestation (E9.5–E15.5) significantly increased placental Abcb1a mRNA. In conclusion, glucocorticoids exhibit complex regulation of the P-gp transport system at the level of gene transcription and translation. Dexamethasone exposure up-regulates Abcb1a mRNA and P-gp protein, particularly in late gestation. However, these changes do not appear to be reflected by changes in P-gp mediated drug transfer. While the latter is somewhat reassuring with respect to antenatal use of glucocorticoids for management of preterm labour, further studies are required to understand regulation of these important drug transporters in the placenta.
Keywords: Placenta, Abcb1, Multidrug resistance phosphoglycoprotein, Dexamethasone, [3H]Digoxin
1. Introduction
The multidrug resistance phosphoglycoprotein (P-gp; encoded by Abcb1 gene) was first discovered in multidrug resistant tumour cells, where it was shown to reduce cellular accumulation of chemotherapeutic agents [1]. Subsequently, murine multidrug resistance genes (Abcb1a and Abcb1b) were identified and together functionally resemble Abcb1 [2], [3], [4]. In addition to expression in cancer cells, P-gp is expressed in normal tissues where it serves an important role in limiting absorption and/or facilitating excretion of a wide range of substrates by actively transporting substrates from the inner to outer leaflet of the cell membrane [2], [3], [5], [6]. Tissues with specialized barrier functions such as the blood–brain, blood–testes and maternal–fetal barrier also express P-gp [7], [8], [9], [10], [11], although information in the human and murine pertaining to the regulation and functional significance of P-gp in these tissues is limited.
Solutes can cross the placenta by passive diffusion, occurring via a paracellular or transcellular route as well as via processes involving pinocytosis, filtration, facilitated diffusion and active transport [12], [13], [14]. Digoxin is a 780 MW lipophilic molecule which passively diffuses via the transcellular pathway [13]. Digoxin is a specific substrate for P-gp and once it has entered the plasma membrane lipid bilayer P-gp is activated to pump digoxin out of the cell [15], [16], [17]. However, depending on the concentration of digoxin and the presence of functional P-gp, some digoxin continues to diffuse across the syncitiotrophoblast, eventually entering fetal circulation. The functional importance of placental P-gp in limiting fetal digoxin accumulation has been verified on E15.5 with the use of Abcb1a/Abcb1b knockout mice [18].
In both the mouse and human, we and others have recently shown that placental P-gp, localized within the apical membrane of the syncitium, is highly expressed at mid-gestation but dramatically declines near term [8], [9], [19], corresponding to a significant increase in net transplacental transfer of [3H]digoxin (a robust pharmacological probe for assessing P-gp function) [20], [21]. Overall, this suggests a decrease in global protection provided by the placenta to the developing fetus with advancing gestation. Other studies in the mouse, have shown that P-gp plays a crucial role in preventing transplacental transfer of a number of exogenous substrates; thus protecting the developing fetus from their potential adverse effects [18], [21], [22]. Despite these dramatic changes in mouse and human placental P-gp expression and function in late gestation, little is known with regards to regulation. Steroids have previously been shown to regulate Abcb1 gene expression in other tissues in the rat and mouse. For example, progesterone and estrogen are important regulators of Abcb1 gene expression in uterine tissue [18], [23], [24], [25]. However, we have recently shown that progesterone at physiological concentrations does not appear to exert a regulatory role on mouse placental P-gp [20], a finding recently corroborated in the rat [26]. Maternal plasma glucocorticoid levels increase exponentially in late gestation in all mammals [27], [28], [29], [30], [31]. Further, placental sensitivity to glucocorticoids increases with advancing gestation [32], [33]. This increase coincides with the down-regulation of placental Abcb1a, Abcb1b mRNA and P-gp, suggesting a potential regulatory role [9]. Given the difference in placental sensitivity to glucocorticoids and the low levels of P-gp on E18.5, we predicted that glucocorticoid regulation of placental P-gp would change as a function of gestational age and that glucocorticoid effects may be limited near term. Synthetic glucocorticoids are administered to approximately 10% of all pregnant women during the management of threatened preterm labour [34]. This treatment is very effective in bringing about the premature maturation of the fetal lung [35], however, due to the difficulty in diagnosing preterm labour, many fetuses that go on to deliver at normal term are exposed to synthetic glucocorticoid [34].
Dexamethasone has been shown to regulate P-gp expression in other barrier tissues (blood–brain barrier) and in vitro [36], [37], [38], [39]. To date, there is virtually no information on the potential glucocorticoid regulation of placental P-gp, in vivo. A single study has investigated the regulatory role of dexamethasone on placental Abcb1 mRNA expression in the rat placenta [26]. However, in the rat, the ontogenic profile of placental Abcb1 mRNA and P-gp differs compared to that shown in the human and mouse placenta. Determining the regulation of placental P-gp would be valuable for the development of improved strategies for maternal and fetal therapies as well as improved fetal protection. In this study, we hypothesized that exposure to synthetic glucocorticoid (dexamethasone) will: 1) result in a down-regulation of both Abcb1 mRNA isoforms and P-gp within the placental barrier, 2) increase substrate accumulation in the fetal compartment and 3) that these regulatory effects are both gestational age and dose-dependent.
2. Materials and methods
Female FVB mice (Charles River, Germantown, NY) were bred in our colony. Pregnancy was defined after presence of vaginal plug and designated as E0.5 (average gestation period ∼ 19.5 days). All animals were identically housed and provided with standard chow ad libitum (Teklad 2018, Harlan Laboratories, Mississauga, Canada). These studies were performed using protocols approved by the Animal Care Committee at the University of Toronto and in accordance with the Canadian Council for Animal Care.
2.1. Glucocorticoid regulation of Abcb1/P-gp expression and function
Glucocorticoid regulation was examined in two groups of pregnant FVB mice. In the first group, pregnant dams were injected (s.c.) daily (0900 h) with either dexamethasone (pharmacological doses of 0.1 mg/kg; n = 7 dams/gp or 1 mg/kg; n = 5 dams/gp) or vehicle (saline; n = 4 dams/gp) from embryonic day (E) 9.5 to E15.5 (mid-gestation). In the second group, pregnant dams were injected (s.c.) daily (0900 h) with dexamethasone (0.1 mg/kg; n = 7 dams/gp or 1 mg/kg; n = 5 dams/gp) or vehicle (saline; n = 4 dams/gp) from E12.5 to E18.5. Glucocorticoid treatment during the last week of gestation (E12.5–E18.5) has been used in murine models to mimic antenatal glucocorticoid treatment [26], [40]. We chose an equivalent treatment regimen (E9.5–E15.5) earlier in gestation to take into account differences in placental glucocorticoid sensitivity and ontogenic expression of Abcb1 mRNA and P-gp [9]. On the last day (E15.5 or E18.5), 2 h after dexamethasone or vehicle injection, [3H]digoxin (pharmacological probe for P-gp; 50 μg/kg and 1 μCi/animal) was injected directly into the tail vein and dams were then euthanized 1 h later with pentobarbital (120 mg/kg i.p.; MTC Pharmaceuticals, ON, Canada) [20], [21], [41]. Maternal blood was collected via cardiac puncture and plasma was separated for analysis. ‘Fetal-units’ (∼2/litter/gp; arbitrarily selected from each litter) were weighed at the time of dissection. The ‘fetal-unit’ consists of all the elements in direct contact with the fetal placenta/labyrinth: The fetus, amniotic fluid and intact fetal membranes, but not the placenta [20]. Considering that the amniotic fluid and fetal membranes contain substrate which has traversed the placenta from maternal circulation, substrate accumulation in the ‘fetal-unit’ provides an index of net transplacental transfer. From the remainder of the litter, fetuses and placentae were collected, weighed at the time of dissection and stored at −80 °C. Fetal tails were collected and stored at −20 °C for sex determination of placentae. Tails were not obtained from ‘fetal-units’ as we did not want to rupture the fetal membranes. For analysis of function, ‘fetal-units’ were processed as previously described [20], [21]. Digoxin does not attain steady state between the maternal blood and the fetal compartment until after 4 h post-injection [21]. Digoxin is not readily metabolized and the recovery rate of [3H]digoxin in the mouse is 95% after 4 h [18]. Tissue Processing: A volume of PBS equivalent to two times the ‘fetal-unit’ weight was added and ‘fetal-units’ were homogenized. Maternal plasma (100 μl) and fetal tissue (200 μl) were solubilized in SOLVABLE following the manufacturers’ recommendations (PerkinElmer, Boston, Massachusetts, USA). Hydrogen peroxide (0.1 ml of 30%) was added to decolorize samples and optimize counting efficiency, followed by scintillation fluid (10 ml; Ultima-Gold, PerkinElmer, Boston, Massachusetts, USA). Radioactivity (DPM) was determined on a Tri-Carb Beta-Counter (PerkinElmer, Boston, Massachusetts, USA). Levels of [3H]digoxin were standardized as a drug equivalent per weight or volume. For ‘fetal-unit’, drug distribution was expressed as the ratio of tissue concentration (DPM/gram tissue weight) to maternal plasma concentration (DPM/ml plasma volume); designated ‘drug ratio’ [21]. For each dam, ‘drug ratio’ values derived for individual ‘fetal-units’ (∼2 per dam) were averaged to provide a litter mean, which was then used for subsequent statistical analysis.
2.2. Sex determination
DNA was extracted from fetal tails and PCR was performed to determine fetal sex using Sry forward: 5′ TCATGAGACTGCCAACCACAG 3′; Sry reverse: 5′ CATGACCACCACCACCACCAA 3′ primers [42] according to manufacturer’s guidelines (Sigma REDExtract-N-AMP Tissue PCR Kit (XNAT), Sigma Chemical Co. St Louis, MO). Amplification product was detected by 1% gel electrophoresis.
2.3. RNA extraction
Total RNA was extracted from one male and one female placenta that were arbitrarily selected for each litter in each treatment group using TRIzol as per manufacturer’s instructions (Invitrogen Canada Inc, Burlington, Ontario, Canada). Briefly, after phase separation, the upper aqueous phase was removed and followed by RNA precipitation with isopropyl alcohol. The RNA pellet was then washed with 75% ethanol and RNA was then redissolved in 50 μl of RNase/DNase free water (Invitrogen Canada Inc, Burlington, Ontario, Canada) and immediately frozen. Total RNA was subjected to reverse-transcription using High Capacity cDNA Reverse Transcription kit (Applied Biosystems).
2.4. Real-time PCR
Real-time PCR was performed using the FAM-labeled TaqMan gene expression assays for Abcb1a, Abcb1b and glyceraldehyde-3-phosphate dehydrogenase (Gapdh) mRNA (Mm00440761_m1, Mm00440736_m1 and 4352932E; Applied Biosystems, Foster City, CA) and the TaqMan Universal PCR Mix (Applied Biosystems) [20]. Abcb1a and Abcb1b mRNA expression was quantified on a Chromo4 real-time PCR detector (Bio-Rad Laboratories) with the following cycling conditions: activation at 50 °C for 2 min, initial denaturation at 95 °C for 10 min. 35 cycles were then performed of denaturation at 95 °C for 15 s, annealing and extension at 60 °C for 60 s, plate read. All samples were run in triplicate. Data were analyzed using Opticon software (Bio-Rad Laboratories) and relative quantification was calculated ΔΔCT with Gapdh as the endogenous control [43]. Selection of an appropriate endogenous control for mouse studies was performed by analyzing the expression of placental Gapdh across gestation and with treatment, which was run in parallel to target gene. Briefly, a validation experiment was undertaken where equal quantities of mouse placental cDNA were used and similar amplification efficiencies and CT values were obtained for Gapdh with treatment (dexamethasone versus vehicle; data not shown). The stability of Gapdh expression validated the use of this gene for normalization. Further, similar amplification efficiencies were obtained for both the target genes (Abcb1a and Abcb1b) and our house-keeping gene (data not shown).
2.5. Western blot analysis
P-gp protein expression was assessed by Western blotting, as described previously [9]. Briefly, frozen placenta was prepared for electrophoresis. Given that sex differences were not observed in Abcb1 mRNA expression and functional data could not be assessed for sex difference, 12.5 μg of protein from one male and one female placenta were combined per litter per treatment group. Samples (25 μg protein total) were subjected to SDS-PAGE electrophoresis and transferred to a nitrocellulose membrane (8% resolving gel). Nitrocellulose membranes were blocked overnight (4 °C) in skim milk (5% wt/vol of PBS with Tween 20: PBS-T). Membranes were washed with PBS-T and cut at the 50 kDa mark. The upper half was then incubated with C219 mouse monoclonal antibody (1:250 dilution, 1 h, 23 °C; Calbiochem, 517312; La Jolla, California) and the lower half incubated with β-actin (β-actin; 1:5000 dilution, rabbit polyclonal A2066; Sigma Chemical Co. St Louis, MO). C219 is a well characterized antibody for the specific detection of P-gp [44]. The membranes were then washed and incubated with anti-mouse or anti-rabbit IgG respectively (1:5000 dilution, 1 h, 23 °C; NEN, Boston, USA) followed by Western Lightning Chemiluminescence Reagent Plus (Perkin Elmer). Bands were visualized by exposure to Kodak Blue X-OMAT film (Perkin Elmer). The relative optical density (ROD) of the bands was measured using computerized image analysis and was standardized against the β-actin signal (MCID TM Core 7.0, Imaging Research Inc., Interfocus Imaging Ltd., Cambridge, England). Western analysis was performed in duplicates for each placenta. Currently, there are no antibodies available that differentiate between the isoforms of P-gp, thus Western analysis represents the levels of both isoforms. The specificity of the antibody which detects the 170 kDa band was confirmed by pre-absorption of the primary antibody with excess protein epitope [9].
2.6. Statistical analysis
Group data are presented as means ± standard error of the mean (SEM). Data were tested for normality and where this did not occur data were log10 transformed prior to parametric analysis. ‘Fetal-unit’ accumulation (∼2 ‘fetal-units’ per dam) and weight data (entire litter, average of 8.24 ± 0.23 fetuses meaned per dam) were statistically analyzed using One-Way ANOVA for comparison; differences between dexamethasone and vehicle treatment groups were determined by One-Way ANOVA, followed by Newman–Keuls post-hoc comparison, using Prism (GraphPad Software Inc., San Diego, California, USA). Data is expressed as mRNA levels following dexamethasone treatment standardized to endogenous control (Gapdh) and then normalized to control (saline treatment; only control values obtained from parallel real-time run were utilized) and analyzed using Student’s t-test. Data for Abcb1b mRNA (dexamethasone 0.1 mg/kg) at E18.5 was also log10 transformed and normally distributed after transformation. Where data (Abcb1a mRNA (dexamethasone 0.1 mg/kg) at E18.5 and Abcb1b mRNA (dexamethasone 0.1 mg/kg) at E15.5) was not normally distributed after transformation, the Mann–Whitney test was used. Data for protein is expressed as relative optical density (ROD) standardized to endogenous control (β-actin) and analyzed using Student’s t-test. Significance was set at P < 0.05. There was no overall significant effect of sex on expression of Abcb1 mRNA or function. As such, data from male and female fetuses were combined within each litter.
3. Results
3.1. Effect of dexamethasone on placental and fetal weights
Daily injections of dexamethasone (1 mg/kg) during mid-gestation (E9.5–E15.5) resulted in a significant (P < 0.05) reduction in placental weight on E15.5 when compared to vehicle, while the lower dose of dexamethasone (0.1 mg/kg) did not significantly affect placental weight (Fig. 1A). Neither dose of dexamethasone significantly altered placental weight on embryonic day (E) 18.5 (Fig. 1B). One-Way ANOVA revealed profound effects of synthetic glucocorticoid exposure on fetal growth during mid-gestation (P < 0.001). Dexamethasone treatment (0.1 mg/kg and 1 mg/kg) resulted in a 22% and 41% reduction in fetal body weight respectively on E15.5 compared to vehicle treated controls (Newman–Kuels, P < 0.05 and P < 0.001; Fig. 1C). On E18.5, only high dose dexamethasone (E12.5–E18.5; 1 mg/kg) reduced fetal body weight by 28% (Newman–Kuels, P < 0.05; Fig. 1D).

Fig. 1
Tissue weight following daily injections of dexamethasone (0.1 mg/kg, 1 mg/kg) or vehicle (VEH) from embryonic day (E) 9.5–E15.5 or E12.5–E18.5. (A) Placenta weight following dexamethasone treatment E15.5 (vehicle (VEH) n = 10 litters/group; 0.1 mg/kg, n = 6 litters/group; 1 mg/kg, n = 5 litters/group) and (B) E18.5 (VEH, n = 12 litters/group; 0.1 mg/kg, n = 6 litters/group; 1 mg/kg, n = 5 litters/group). (C) Fetal body weight following dexamethasone treatment on E15.5 (VEH, n = 10 litters/group; 0.1 mg/kg, n = 7 litters/group; 1 mg/kg, n = 5 litters/group) and (D) E18.5 (VEH, n = 9 litters/group; 0.1 mg/kg, n = 5 litters/group; 1 mg/kg, n = 5 litters/group). Bar represents mean ± SEM tissue weight in grams (g). *P < 0.05, ***P < 0.001.
3.2. Dexamethasone regulation of placental Abcb1a, Abcb1b mRNA
Dexamethasone (1 mg/kg) treatment significantly increased placental Abcb1a mRNA, but had no effect on Abcb1b mRNA on E15.5 (Student’s t-test, P < 0.05; Fig. 2A and B). There was no significant effect of dexamethasone (0.1 mg/kg) treatment during mid-gestation on either placental Abcb1a or Abcb1b mRNA at E15.5 (Fig. 2A and B). However, placental Abcb1a mRNA showed a strong trend toward decreased expression compared to vehicle (E15.5; P = 0.057; Fig. 2A). During late gestation (E12.5–E18.5), dexamethasone (0.1 mg/kg) treatment did not significantly alter either Abcb1a or Abcb1b mRNA when measured on E18.5, though there were trends towards an increase in both isoforms (Fig. 2C and D). High dose dexamethasone (1 mg/kg) during the late gestation significantly up-regulated placental Abcb1a mRNA expression compared to vehicle (Student’s t-test, P < 0.05; Fig. 2C). Similar to earlier in gestation, Abcb1b mRNA remained unaffected by dexamethasone treatment (Fig. 2D).

Fig. 2
Placental Abcb1 mRNA expression following dexamethasone 0.1 mg/kg (DEX 0.1), dexamethasone 1 mg/kg (DEX 1) or vehicle (VEH 0.1 or VEH 1). (A) Abcb1a mRNA on embryonic day (E)15.5 (DEX 0.1, n = 10 placentae/group; DEX 1, n = 5 placentae/group and their corresponding vehicle (VEH) 0.1, n = 11 placentae/group; VEH 1, n = 8 placentae/group), (B) Abcb1b mRNA on E15.5 (DEX 0.1, n = 10 placentae/group; DEX 1, n = 10 placentae/group and their corresponding vehicle VEH 0.1, n = 13 placentae/group; VEH 1, n = 9 placentae/group), (C) Abc1b1a mRNA on E18.5 (DEX 0.1, n = 4 placentae/group; DEX 1, n = 9 placentae/group and their corresponding vehicle VEH 0.1, n = 8 placentae/group; VEH 1, n = 10 placentae/group) and (D) Abcb1b mRNA on E18.5 (DEX 0.1, n = 5 placentae/group; DEX 1, n = 5 placentae/group and their corresponding vehicle VEH 0.1, n = 8 placentae/group; VEH 1, n = 7 placentae/group). Bar represents mean ± SEM expressed as relative units of mRNA standardized against Gapdh. Treatment data was then normalized to corresponding vehicle (run in parallel to treatment). *P < 0.05.
3.3. Dexamethasone regulation of placental P-gp expression
During mid-gestation, placental P-gp levels were not significantly altered by dexamethasone treatment at either dose when compared to vehicle (Fig. 3A and B). However, a trend toward up-regulation of placental P-gp was observed. In contrast, dexamethasone treatment (0.1 mg/kg and 1 mg/kg) in late gestation significantly increased placental P-gp expression when compared to vehicle (P = 0.02 and P = 0.0038 respectively; Fig. 3C–E).

Fig. 3
Placental P-gp on embryonic day (E) 15.5 from (A) dexamethasone 0.1 mg/kg (DEX 0.1) or vehicle (VEH; n = 5 placentae/group) or (B) dexamethasone 1 mg/kg (DEX 1) or vehicle (VEH; n = 5 placentae/group) treated dams. (C) Representative blot of placental P-gp on E18.5 following vehicle (VEH) and dexamethasone (DEX) 1 mg/kg treatment. Placental P-gp on E18.5 from (D) dexamethasone 0.1 mg/kg (DEX 0.1) or vehicle (VEH; n = 5 placentae/group) or (E) dexamethasone 1 mg/kg (DEX 1) or vehicle (VEH; n = 5 placentae/group) treated dams. Bar represents mean ± SEM expressed as relative optical density (ROD) standardized against β-actin. *P < 0.05, **P < 0.01.
3.4. Dexamethasone regulation of placental P-gp function
Daily injections of dexamethasone (0.1 mg/kg or 1 mg/kg) during mid-gestation had no significant effects on the accumulation of [3H]digoxin in the ‘fetal-unit’, on E15.5 (Fig. 4A). However, lower dose dexamethasone (0.1 mg/kg) treatment, but not high dose treatment (1 mg/kg), during the last week of gestation significantly increased [3H]digoxin accumulation in the ‘fetal-unit’ on E18.5 (P < 0.05; Fig. 4B).

Fig. 4
Transplacental transfer of [3H]digoxin (50 μg/kg) to the ‘fetal-unit’ on: (A) embryonic day (E)15.5 after daily injections of dexamethasone (DEX) 0.1 mg/kg (n = 7 litters/group), 1 mg/kg (n = 5 litters/group) or vehicle (VEH; n = 5 litters/group) from E9.5-E15.5. (B) E18.5 after daily injections with dexamethasone (0.1 mg/kg (n = 6 litters/group), 1 mg/kg (n = 7 litters/group)) or vehicle (n = 10 litters/group) from E12.5-E18.5. Values are expressed as treatment group means. Bar represents mean ± SEM drug ratio (DPM/g fetal tissue, membranes and amniotic fluid: DPM/ml maternal plasma). ***P < 0.001.
4. Discussion
The present study has, for the first time, examined the regulation of mouse placental Abcb1a and Abcb1b mRNA, P-gp protein expression and function in vivo by synthetic glucocorticoid. We have shown that synthetic glucocorticoid (dexamethasone) exposure alters placental Abcb1a mRNA expression during mid- and late gestation in an age-dependent manner. However, the effects of dexamethasone on Abcb1a mRNA and P-gp protein expression do not correlate with changes in placental P-gp mediated ‘fetal-unit’ drug accumulation.
The human and mouse definitive placenta displays several similarities; both are chorio-allantoic and are haemochoriol [45], [46]. There are cellular and molecular similarities between the placentae of both species [47], [48]. Further, the human and mouse Abcb1 gene promoters have been characterized and the regulatory regions demonstrate significant homology [49], [50]. As such, in vivo studies, undertaken at various stages of mouse gestation, can significantly contribute to our understanding of function and regulation of human placental Abcb1 and P-gp.
Synthetic glucocorticoids are administered to approximately 10% of all pregnant women in the management of threatened preterm labour [34]. Given the functional importance of placental P-gp in limiting transplacental transfer of substrates originating in maternal circulation, the potential regulatory effects of glucocorticoids on placental P-gp expression and function is of importance [20]. Consistent with previous reports, daily treatment with dexamethasone resulted in fetal growth restriction [26], [51]. Interestingly, unlike the rat, where a profound decrease in placental weight is observed following dexamethasone treatment (0.1 mg/kg) during the last week of gestation, in the present study, neither of the doses of dexamethasone resulted in altered placental weight. Nonetheless, following high dose dexamethasone treatment, fetuses were 28% growth restricted at E18.5. A previous study identified a similar substantial effect of maternal dexamethasone treatment (0.5 mg/kg) on fetal weight with relatively little impact on placental weight [52]. In the present study, dexamethasone-induced fetal and placental growth restriction was more pronounced following the early phase treatment ending on E15.5. Changes in placental and fetal body growth at either time in gestation did not correspond to altered P-gp function. This suggests that placental P-gp function is not dependent on placental weight alone.
There was an isoform-specific effect of dexamethasone on placental Abcb1 mRNA expression at E15.5 and E18.5. This is consistent with previous studies that examined the effects of dexamethasone on Abcb1a and Abcb1b mRNA in the placenta and other tissues including the colon, brain and liver [26], [53]. The positive regulatory effect of dexamethasone on Abcb1a mRNA that we have identified, in vivo, is consistent with in vitro studies using BeWo or JEG3 cells (placental cell lines) [54]. The precise mechanism by which placental Abcb1a mRNA is regulated by dexamethasone, in the absence of effects on Abcb1b mRNA, remains to be determined.
To our knowledge, a single previous study in the rat has examined the effects of dexamethasone on placental Abcb1 mRNA in vivo during the last week of gestation [26]. However, placental P-gp function was not examined [26]. In contrast to the present study, dexamethasone exposure resulted in a down-regulation of placental Abcb1a mRNA in the rat. This could result from species differences or differences in the formulation and dose of dexamethasone utilized. Nonetheless, both studies demonstrate that dexamethasone specifically regulated placental Abcb1a mRNA, rather than Abcb1b mRNA (the primary isoform in the mouse placenta) [9]. The functional significance of altered Abcb1a mRNA on placental P-gp function is not clear and requires further investigation.
Isoform-specific regulatory effects of dexamethasone may be attributable to differences between Abcb1a and Abcb1b promoters [3], [49], [55], [56]. Moreover, the interaction of other endogenous regulatory factors (i.e. steroids, cytokines) present in circulation, or the expression of key nuclear receptors or other transcription factors may result in indirect regulatory effects of dexamethasone. For example, in vitro, estradiol has been shown to modulate the regulatory effect of cortisol on glucocorticoid receptor (GR) activation [57]. Information pertaining to the regulation of Abcb1a and Abcb1b is extremely limited and further research to elucidate the mechanism underlying glucocorticoid mediated regulation of Abcb1a and, Abcb1b is required.
In addition to increasing Abcb1a mRNA, dexamethasone exposure in late gestation (E18.5) significantly increased placental P-gp protein expression, a trend that is also apparent earlier in gestation. However, these changes in protein expression did not translate to altered ‘fetal-unit’ [3H]digoxin accumulation. This disparity between protein expression and function is of considerable interest because a number of recent studies have shown a rather limited relationship between protein expression and active protein [58]. In the mouse, unlike the rat, P-gp expression is almost exclusively localized to the labyrinth zone [9]. As such, the discrepancy between P-gp expression and function in this study is not likely a result of expression differences in the two placental zones (labyrinth and junctional). However, it is likely that this disconnect relates more to the location of the protein being measured. In the majority of studies, including the present study, P-gp protein has been measured in total tissue extract, rather than in the membrane fraction, where P-gp activity is localized. Therefore, while dexamethasone may increase total cellular P-gp content, this additional protein may not be incorporated into the membrane. Further studies are required to determine the levels of P-gp protein in the membrane fraction following exposure to synthetic glucocorticoid.
Rapid transcellular diffusion of digoxin occurs across the syncitiotrophoblast plasma membrane, where it is either actively transported back into maternal circulation by P-gp or continues to diffuse across the syncitiotrophoblast into the fetal circulation. As such, P-gp activity is rate limiting in the transfer of digoxin from the maternal circulation to the fetal compartment [12]. The ability of P-gp in the syncitiotrophoblast to transport substrates out of the cell can be affected by changes in P-gp levels or altered transporter function. The latter can be affected through: 1) Competition for P-gp transport capacity [59]. 2) Binding to an allosteric site that then alters protein structure and drug-binding capacity [60]. 3) Affecting ATPase activity, and therefore affecting energy supply for P-gp function [61].
Dexamethasone is also a P-gp substrate, and, as such, it is possible that [3H]digoxin and dexamethasone compete for P-gp and affect transport capacity [62]. In this regard, P-gp has been shown to transport digoxin with higher efficiency than dexamethasone [63]. Drug–drug interactions between digoxin and dexamethasone may, at least in part, explain why we observed substantial disparity between placental P-gp levels (by Western blotting) and [3H]digoxin accumulation in the ‘fetal-unit’ on E18.5 following maternal dexamethasone treatment (0.1 mg/kg). However, in the higher dose group, [3H]digoxin accumulation was similar to controls, perhaps indicating other direct actions of dexamethasone on P-gp activity. These may include modification of P-gp incorporation into the membrane as well as alteration of P-gp glycosylation or phosphorylation [64]. Clearly further studies are required to investigate these possibilities as this relationship appears complex since it does not occur at the higher dose of dexamethasone or when dexamethasone is administered earlier in gestation.
From a clinical perspective, approximately 10% of all pregnant women are treated with synthetic glucocorticoids (dexamethasone and betamethasone) in cases of suspected preterm labour. These glucocorticoids pass across the placenta and promote fetal lung development and prevent respiratory distress syndrome. While maternal treatment with glucocorticoids alters P-gp expression in the mouse placenta, the minimal effect of dexamethasone on placental P-gp activity that we describe in the present study is perhaps reassuring.
In conclusion, it is clear that glucocorticoid regulation of Abcb1 mRNA and P-gp in the placenta is complex. Glucocorticoid exposure up-regulates Abcb1a mRNA and P-gp protein, particularly in late gestation. However, these changes do not appear to be reflected by changes in P-gp mediated drug transfer.
Acknowledgements
This study was funded by the Canadian Institutes for Health Research (FRN-57746; to S.G.M. and W.G. and Doctoral Research Award to S.P.).
References
- . Surface glycoprotein modulating drug permeability in Chinese-hamster ovary cell mutants. Biochim Biophys Acta. 1976;455:152–162
- . Cellular localization of the multidrug-resistance gene product P-glycoprotein in normal human tissues. Proc Natl Acad Sci U S A. 1987;84:7735–7738
- The three mouse multidrug resistance (mdr) genes are expressed in a tissue-specific manner in normal mouse tissues. Mol Cell Biol. 1989;9:1346–1350
- . Biochemistry of multidrug resistance mediated by the multidrug transporter. Annu Rev Biochem. 1993;62:385–427
- . Expression of the multidrug resistance gene product (P-glycoprotein) in human normal and tumor tissues. J Histochem Cytochem. 1990;38:1277–1287
- . Photosensitized labeling of a functional multidrug transporter in living drug-resistant tumor cells. J Biol Chem. 1990;265:3975–3980
- . Stage-specific distribution of P-glycoprotein in first-trimester and full-term human placenta. Histochem J. 1994;26:417–423
- . Expression of the multidrug resistance P-glycoprotein, (ABCB1 glycoprotein) in the human placenta decreases with advancing gestation. Placenta. 2006;27:602–609
- . Multidrug resistance phosphoglycoprotein (ABCB1) in the mouse placenta: fetal protection. Biol Reprod. 2005;73:591–597
- . Sites of mRNA expression of the cystic fibrosis (CF) and multidrug resistance (MDR1) genes in the human placenta of early pregnancy: no evidence for complementary expression. Placenta. 1999;20:493–496
- Function of P-glycoprotein expressed in placenta and mole. Biochem Biophys Res Commun. 1997;235:849–853
- . The fate and effects of xenobiotics in human placenta. Expert Opin Drug Metab Toxicol. 2007;3:331–346
- . Extracellular transport pathways in the haemochorial placenta. Placenta. 1989;10:113–119
- . Placental transfer of drugs administered to the mother. Clin Pharm. 1995;28:235–269
- . Placental transporters relevant to drug distribution across the maternal-fetal interface. J Pharmacol Exp Ther. 2000;294:413–420
- Kinetic analysis of P-glycoprotein-mediated transport by using normal human placental brush-border membrane vesicles. Pharm Res. 2003;20:38–44
- Human placental transport of vinblastine, vincristine, digoxin and progesterone: contribution of P-glycoprotein. Eur J Pharmacol. 2000;408:1–10
- Normal viability and altered pharmacokinetics in mice lacking mdr1-type (drug-transporting) P-glycoproteins. Proc Natl Acad Sci USA. 1997;94:4028–4033
- . Effect of pregnancy on cytochrome P450 3a and P-glycoprotein expression and activity in the mouse: mechanisms, tissue specificity, and time course. Mol Pharmacol. 2008;74:714–723
- . Functional changes of mouse placental multidrug resistance phosphoglycoprotein (ABCB1) with advancing gestation and regulation by progesterone. Reprod Sci. 2007;14:321–328
- . Absence or pharmacological blocking of placental P-glycoprotein profoundly increases fetal drug exposure. J Clin Invest. 1999;104:1441–1447
- . Placental P-glycoprotein deficiency enhances susceptibility to chemically induced birth defects in mice. Reprod Toxicol. 1998;12:457–463
- . The gene encoding multidrug resistance is induced and expressed at high levels during pregnancy in the secretory epithelium of the uterus. Proc Natl Acad Sci USA. 1988;85:4350–4354
- . Progesterone regulates the murine multidrug resistance mdr1b gene. J Biol Chem. 1993;268:7613–7616
- . Progesterone interacts with P-glycoprotein in multidrug-resistant cells and in the endometrium of gravid uterus. J Biol Chem. 1989;264:782–788
- . Changes in the placental glucocorticoid barrier during rat pregnancy: impact on placental corticosterone levels and regulation by progesterone. Biol Reprod. 2009;80:1209–1215
- . Glucocorticoids and the preparation for life after birth: are there long-term consequences of the life insurance?. Proc Nutr Soc. 1998;57:113–122
- . Glucocorticoid therapy in the fetus and newborn–Introduction. Semin Neonatol. 2001;6:283–284
- . Plasma corticosterone levels during pregnancy in the mouse: the relative contributions of the adrenal glands and feto-placental units. J Endocrinol. 1974;60:473–483
- . Pre-parturitional changes in serum prolactin, placental lactogen, growth hormone, progesterone, and corticosterone in the C3H/HeN mouse. J Dev Physiol. 1984;6:423–429
- . Corticosterone is required for the prolactin receptor gene expression in the late pregnant mouse mammary gland. Mol Cell Endocrinol. 1997;132:177–183
- . Spatial and temporal patterns of expression of 11beta-hydroxysteroid dehydrogenase types 1 and 2 messenger RNA and glucocorticoid receptor protein in the murine placenta and uterus during late pregnancy. Biol Reprod. 2002;67:1708–1718
- . Ontogeny of glucocorticoid receptor and 11beta-hydroxysteroid dehydrogenase type-1 gene expression identifies potential critical periods of glucocorticoid susceptibility during development. J Endocrinol. 2004;181:105–116
- . Overexposure to antenatal corticosteroids: a global concern. J Obstet Gynaecol Can. 2007;29:879
- . Fetal programming of hypothalamic-pituitary-adrenal (HPA) axis function and behavior by synthetic glucocorticoids. Brain Res Rev. 2008;57:586–595
- Dexamethasone regulation of P-glycoprotein activity in an immortalized rat brain endothelial cell line. GPNT J Neurochem. 1999;73:1954–1963
- Dexamethasone increases expression and activity of multidrug resistance transporters at the rat blood–brain barrier. Am J Physiol, Cell Physiol. 2008;295:C440–C450
- Morphological and functional changes in p-glycoprotein during dexamethasone-induced hepatomegaly. Clin Exp Pharmacol Physiol. 2007;34:296–303
- . Pregnane X receptor up-regulation of P-glycoprotein expression and transport function at the blood–brain barrier. Mol Pharmacol. 2004;66:413–419
- . Glucocorticoid exposure in late gestation in the rat permanently programs gender-specific differences in adult cardiovascular and metabolic physiology. Am J Physiol Endocrinol Metab. 2004;287:E863–E870
- Substantial excretion of digoxin via the intestinal mucosa and prevention of long-term digoxin accumulation in the brain by the mdr1a P-glycoprotein. Br J Pharmacol. 1996;119:1038–1044
- . Rapid DNA extraction and PCR-sexing of mouse embryos. Mol Reprod Dev. 2001;60:225–226
- . A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001;29:e45
- . Characterization of a new antibody raised against the NH2 terminus of P-glycoprotein. Clin Cancer Res. 2005;11:5833–5839
- Genes, development and evolution of the placenta. Placenta. 2003;24:123–130
- . A comparison of placental development and endocrine functions between the human and mouse model. Hum Reprod Update. 2003;9:531–539
- . Comparative developmental anatomy of the murine and human definitive placentae. Placenta. 2002;23:3–19
- . Placental development: lessons from mouse mutants. Nat Rev Genet. 2001;2:538–548
- . Structural analysis of the mouse mdr1a (P-glycoprotein) promoter reveals the basis for differential transcript heterogeneity in multidrug-resistant J774.2 cells. Mol Cell Biol. 1990;10:3596–3606
- . Isolation and sequence of the promoter region of the human multidrug-resistance (P-glycoprotein) gene. J Biol Chem. 1987;262:17432–17436
- . Dexamethasone-induced intrauterine growth restriction impacts the placental prolactin family, insulin-like growth factor-II and the Akt signaling pathway. J Endocrinol. 2005;185:253–263
- . Antenatal dexamethasone treatment leads to changes in gene expression in a murine late placenta. Placenta. 2007;28:1082–1090
- Using real-time quantitative TaqMan RT-PCR to evaluate the role of dexamethasone in gene regulation of rat P-glycoproteins mdr1a/1b and cytochrome P450 3A1/2. J Pharm Sci. 2004;93:2488–2496
- Examination of glucocorticoid receptor alpha-mediated transcriptional regulation of P-glycoprotein, CYP3A4, and CYP2C9 genes in placental trophoblast cell lines. Placenta. 2007;28:1004–1011
- . Two members of the mouse mdr gene family confer multidrug resistance with overlapping but distinct drug specificities. Mol Cell Biol. 1990;10:1652–1663
- . Structural and functional analysis of the mouse mdr1b gene promoter. J Biol Chem. 1991;266:2239–2244
- . Glucocorticoids modulate human gonadotrophin releasing hormone upstream promoter activity in transfected human placental cells (JEG-3). Mol Hum Reprod. 1998;4:93–99
- . Drug transporters in the human blood–placental barrier. Br J Pharmacol. 2009;158:665–678
- . Positively cooperative sites for drug transport by P-glycoprotein with distinct drug specificities. Eur J Biochem. 1997;250:130–137
- . Competitive and allosteric interactions in ligand binding to P-glycoprotein as observed on an immobilized P-glycoprotein liquid chromatographic stationary phase. Mol Pharmacol. 2001;59:62–68
- . P-glycoprotein and multidrug resistance. Curr Opin Genet Dev. 1996;6:610–617
- . Multidrug-Resistance and the role of P-Glycoprotein knockout mice. Eur J Cancer. 1995;31A:1295–1298
- . Quantitative evaluation of the function of small intestinal P-glycoprotein: comparative studies between in situ and in vitro. Pharm Res. 2003;20:1163–1169
- Differential modulation of P-glycoprotein expression by dexamethasone and 3-methylcholanthrene in rat hepatocyte primary cultures. Carcinogenesis. 1994;15:335–341
PII: S0143-4004(10)00244-4
doi:10.1016/j.placenta.2010.06.014
© 2010 Elsevier Ltd. All rights reserved.
