Placenta
Volume 31, Issue 10 , Pages 910-918, October 2010

The Liver X Receptor (LXR) and its Target Gene ABCA1 are Regulated Upon Low Oxygen in Human Trophoblast Cells: A Reason for Alterations in Preeclampsia?

  • T. Plösch

      Affiliations

    • Center for Liver, Digestive and Metabolic Diseases, Dept. Pediatrics, University Medical Center Groningen, University of Groningen, Groningen, The Netherlands
    • Corresponding Author InformationCorresponding author at: Center for Liver, Digestive and Metabolic Diseases, Laboratory of Pediatrics, University Medical Center Groningen, Hanzeplein 1, 9713 GZ Groningen, The Netherlands. Tel.: +31 50 3614865; fax: +31 50 3611746.
    • T.P. and A.G. contributed equally.
    web address
    • ,
  • A. Gellhaus

      Affiliations

    • Institute of Molecular Biology, University Hospital of Essen, Essen, Germany
    • T.P. and A.G. contributed equally.
    • ,
  • E.M.E. van Straten

      Affiliations

    • Center for Liver, Digestive and Metabolic Diseases, Dept. Pediatrics, University Medical Center Groningen, University of Groningen, Groningen, The Netherlands
    • ,
  • N. Wolf

      Affiliations

    • Institute of Molecular Biology, University Hospital of Essen, Essen, Germany
    • ,
  • N.C.A. Huijkman

      Affiliations

    • Center for Liver, Digestive and Metabolic Diseases, Dept. Pediatrics, University Medical Center Groningen, University of Groningen, Groningen, The Netherlands
    • ,
  • M. Schmidt

      Affiliations

    • Dept. Gynecology, University Hospital of Essen, Essen, Germany
    • ,
  • C.E. Dunk

      Affiliations

    • Dept. Obstetrics and Gynecology, Samuel Lunenfeld Research Institute, Mount Sinai Hospital, Toronto, Canada
    • ,
  • F. Kuipers

      Affiliations

    • Center for Liver, Digestive and Metabolic Diseases, Dept. Pediatrics, University Medical Center Groningen, University of Groningen, Groningen, The Netherlands
    • Center for Liver, Digestive and Metabolic Diseases, Dept. Laboratory Medicine, University Medical Center Groningen, University of Groningen, Groningen, The Netherlands
    • ,
  • E. Winterhager

      Affiliations

    • Institute of Molecular Biology, University Hospital of Essen, Essen, Germany

Accepted 20 July 2010. published online 16 August 2010.

Article Outline

Abstract 

Objectives

The Liver X receptors (LXR) alpha and beta and their target genes such as the ATP-binding cassette (ABC) transporters have been shown to be crucially involved in the regulation of cellular cholesterol homeostasis. The aim of this study was to characterize the role of LXR alpha/beta in the human placenta under normal physiological circumstances and in preeclampsia.

Study design

We investigated the expression pattern of the LXRs and their target genes in the human placenta during normal pregnancy and in preeclampsia. Placental explants and cell lines were studied under different oxygen levels and pharmacological LXR agonists.

Main outcome measures

Gene expressions (Taqman PCR) and protein levels (Western Blot) were combined with immunohistochemistry to analyze the expression of LXR and its target genes.

Results

In the human placenta, LXRA and LXRB expression increased during normal pregnancy. This was paralleled by the expression of their prototypical target genes, e.g., the cholesterol transporter ABCA1. Interestingly, early-onset preeclamptic placentae revealed a significant upregulation of ABCA1. Culture of JAr trophoblast cells and human first trimester placental explants under low oxygen lead to increased expression of LXRA and ABCA1 which was further enhanced by the LXR agonist T0901317.

Conclusions

LXRA together with ABCA1 are specifically expressed in the human placenta and can be regulated by hypoxia. Deregulation of this system in early preeclampsia might be the result of placental hypoxia and hence might have consequences for maternal-fetal cholesterol transport.

Keywords: Maternal-fetal lipid transport, ABCA1, LXRA, Cholesterol, Placenta, Preeclampsia

Abbreviations: ABCA1, ATP-binding cassette transporter, sub-family A, member 1, ABCG1/4/5/8, ATP-binding cassette transporter, sub-family G, member 1/4/5/8, APOA1, apolipoprotein a1, FASN, fatty acid synthase, HDL, high-density lipoprotein, LDL, low-density lipoprotein, LXRA, liver X receptor alpha (nuclear receptor sub-family 1, group H, member 3), LXRB, liver X receptor beta (nuclear receptor sub-family 1, group H, member 2), RXR, retinoid X receptor (nuclear receptor sub-family 2, group b, member 1), SRBI, scavenger receptor class B, member 1, SREBP1C, sterol regulatory element binding protein-1c

 

Back to Article Outline

1. Introduction 

Cholesterol is of crucial importance for all cells in the human body, although dietary intake and cellular demands can vary widely, e.g., during development and in different nutritional states. To maintain cholesterol homeostasis under all metabolic circumstances, sophisticated mechanisms exist to fine-tune cholesterol metabolism at the cellular level as well as cholesterol homeostasis of the embryonic and adult organism as a whole. The Liver X receptors (LXR) alpha (LXRA) and beta (LXRB) have been shown to be crucially involved in the regulation of cellular cholesterol homeostasis in adult mammals [1].

Both LXRs are activated by oxysterols (oxidized cholesterol derivatives), bind to their heterodimer partner Retinoid X Receptor (RXR) and activate transcription of their target genes. Important LXR targets are ATP-binding cassette (ABC) transporters involved in cholesterol efflux from cells to the intestinal lumen or bile (ABCG5/ABCG8), or to high-density lipoproteins (HDL) (ABCA1, ABCG1). Moreover, the LXRs activate transcription of genes responsible for de novo lipogenesis (SREBP1C, FASN) which provide a mechanism to detoxify cholesterol by the formation of cholesterylesters. Overall, activation of LXRs induces mechanisms to protect the cell from the accumulation of cholesterol [2], [3].

LXRA is expressed in a tissue-specific manner, primarily in the liver, kidney, intestine and macrophages, whereas LXRB is more ubiquitously expressed with particularly high levels in the developing brain. These expression patterns suggest regulation of different physiological functions by the two receptors [2], [3]. Studies from LXR knockout mice suggest that LXRA is required for the control of cholesterol metabolism in the liver, while LXRB appears to be a major regulator of glucose homeostasis and energy utilization and of fat storage in muscle and white adipose tissue [4]. Moreover, it has been demonstrated that LXRA and LXRB do not fulfil completely redundant functions, although no clear-cut functional distinction can be made [5].

Both LXRs have been demonstrated to be expressed in the placenta and in choriocarcinoma trophoblast cell lines, e.g., JAr and BeWo [6]. We have previously discussed a vital role of the LXRs for the regulation of intrauterine cholesterol metabolism and proposed LXR-dependent processes as potential targets to direct cholesterol to the fetus [7]. This would provide potential therapeutic tools to ameliorate the clinical outcome in patients with inborn errors of cholesterol metabolism, e.g., the Smith-Lemli-Opitz syndrome. In a series of elegant studies in a mouse model of the Smith-Lemli-Opitz syndrome, the Dhcr7−/− mouse, Tint et al. have shown that a significant proportion of fetal cholesterol originates from the mother [8]. In addition, Lindegaard et al. demonstrated that activation of the LXR pathways by pharmacological LXR agonists increases the expression of Abca1 in the mouse placenta and enhances maternal-fetal cholesterol transfer [9].

Until now, only limited information is available concerning the role of LXR in the human placenta. The villous trophoblast expresses all of the cholesterol transport factors; trophoblast cells express the low-density lipoprotein (LDL) receptor, class A scavenger receptors and scavenger receptor BI (SRBI) for uptake of maternal cholesterol from LDL and HDL particles, respectively [10], [11], [12], [13]. Furthermore, they express high levels of the ABC-transporters ABCA1 and ABCG1, which facilitate transfer of cholesterol to acceptor lipoproteins present in fetal blood thus ensuring cholesterol transport from the maternal to the fetal side [14], [15], [25].

The pregnancy disease preeclampsia, a multisystemic disorder affecting about 5–10% of pregnancies towards the end of the second trimester of gestation, is still one of the leading causes of pregnancy-related maternal and fetal morbidity and mortality [16], [17], [18]. Among its complications, intrauterine growth restriction (IUGR) and premature birth are of clinical relevance. Maternal predisposing factors such as diabetes, hypertension and obesity contribute to the consequences of this condition. Strong evidence supports that preeclampsia is generated by shallow invasion of the extravillous trophoblast into the decidua and an incomplete remodeling of the maternal uterine spiral arteries [18]. This phenomenon leads to an impairment of oxygen supply at the maternal-fetal interface and influences placental angiogenesis and development [19], [20], [21]. Reduced placental blood circulation in turn influences placental transport and bioavailability of metabolites in the embryo. Proteins whose concentrations are selectively associated with preeclampsia include e.g. apolipoprotein E (apoE) [22]. Altered production of the preeclampsia-related apoE3 isoforms might impair reverse cholesterol transport. Together, these findings point to a novel mechanistic link between preeclampsia, lipid transport and subsequent maternal cardiovascular disease.

Surprisingly, data about the role of proteins involved in cholesterol routing and their regulation (e.g., the LXR pathway) in preeclampsia are limited. The objectives of this study were to characterize the expression pattern of LXR and its target genes in human placenta across gestation and in early- and late-onset preeclampsia. We also investigated the effect of the pharmacological LXR agonist T0901317 and hypoxia on LXR and target gene levels in JAr cells and first trimester placental explants.

Back to Article Outline

2. Materials and methods 

2.1. Human placental tissue 

Placental tissues were obtained from the Department of Gynecology and Obstetrics of the University Hospital Essen, Germany, and the Department of Obstetrics and Gynecology, Samuel Lunenfeld Research Institute, Mount Sinai Hospital, Toronto, Canada. First trimester placental tissues from induced abortions without fetal or chromosomal abnormalities were received from the clinic from T. Ring, Essen, Germany, and the Morgentaler Clinic, Toronto, Canada. Written consent was received from women before surgery. The respective ethics committee approved consent forms and protocols for use of the tissue. Gene expression during normal pregnancy was measured in the following four groups: first trimester (6–13 weeks, n = 8), second trimester (14–26 weeks, n = 6), preterm (27–36 weeks, n = 9) and term (37–41 weeks, n = 10). Preeclampsia was diagnosed according to international criteria of the International Society for the Study of Hypertensive Disorders in Pregnancy. Generally preeclampsia was defined as a blood pressure of at least 140/90 mm Hg on two occasions at least 6 h apart occuring after 20 weeks of gestation in women known to be normotensive beforehand, and detectable urinary protein (proteinuria) measured by dipstick ≥1+ (≥30 mg/dL). For this study the following groups were analyzed: pregnancies complicated by severe early-onset preeclampsia (25–33 wk, n = 16) and late preeclampsia (34–39 wk, n = 15) as well as their respective gestational age-matched normal groups (control 1: 23–33 wk, n = 16; control 2: 34–39 wk, n = 12). For the normal control group women with chronic hypertension, renal disease, collagen vascular disease, any evidence of intrapartum infection or other pregnancy complications such as fetal anomalies or chromosomal abnormalities were excluded from this study. For detailed clinical information see Gellhaus et al., Table 1 [23].

Table 1. Primer sequences used in mRNA quantification by real-time RT-PCR.
NameEntrez Gene IDForward primer (5′–3′)Reverse primer (5′–3′)Probe (5′–3′)
18S rRNA100008588CGGCTACCACATCCAAGGACCAATTACAGGGCCTCGAAACGCGCAAATTACCCACTCCCGA
beta-Actin (ACTB)60CTGACTGACTACCTCATGAAGATCCTCTTAATGTCACGCACGATTTCCCAGCTTCACCACCACGGCCGAG
LXRA (NR1H3)10062CTTGCTCATTGCTATCAGCATCTTACATATGTGTGCTGCAGCCTCTTCTGCAGACCGGCCCAACGTG
LXRB (NR1H2)7376GGAGCTGGCCATCATCTCAGTCTCTAGCAGCATGATCTCGATAGTCAGGAGATCGTGGACTTCGCTAAGCAA
RXR (NR2B1)6256GCAAACATGGGGCTGAACCGCTGCTTGGCAAATGTTGGTCAGCTCGCCGAACGACCCTGTC
SREBP1A (SREBF1)6720CTGACCGACATCGAAGACATGAGCATAGGGTGGGTCAAATAGGCAGCTTATCAACAACCAAGACAGTGACTTCCC
SREBP1C (SREBF1)6720GGATTGCACTTTCGAAGACATGAGCATAGGGTGGGTCAAATAGGCAGCTTATCAACAACCAAGACAGTGACTTCCC
ABCA119CCCAGAGCAAAAAGCGACTCGGTCATCATCACTTTGGTCCTTGAGACTACTCTGTTTCTCAGACAACACTTGACCAAGT
ABCG19619CAAGACCCTTTTGAAAGGGATCTCGCCAGAATATTCATGAGTGTGGACCCCATGATGGCCACCAGCTCTCC
ABCG464137GAGCCAGGGTCAGTGCATCTGCAAGCCGAGTCCCTTTAGACAAAGGCGTGGTCACCAACCTGATC
SRBI (SCARB1)949GTCGCAGGCATTGGACAAACCCGCTCTCTGCAAACCAGAGCGGCAGGACCACAGGCTCAATCTTC
LDLR3949CAAAGTCTGCAACATGGCTAGAGAGTTGTCCAAGCATTCGTTGGTCCACTCTTTGATGGGTTCATCTGACCAGTCC
APOA1335ACTGTGTACGTGGATGTGCTCAAAGTTGTCAAGGAGCTTTAGGTTTAGCCAAACTGGGACACATAGTCTCTGCCGCT
FASN2194GGCATCATTGGGCACTCCTTGCTGCAAGCACAGCCTCTCTCCATCTGCATAGCCACAGGCAACCTC

Quantitative real-time PCR was performed as described in Material and Methods. All probes are labeled with FAM and TAMRA at the 5′- and 3′-end, respectively.

For the expression analyses, 3 pieces of villous tissue were taken from the central mid-portion of the fetal placenta between the basal plate and chorionic membrane to avoid contamination with maternal decidua and amniotic membranes. Tissues were processed for preparation of paraffin blocks and the others were snap frozen in liquid Nitrogen and stored at −80 °C for protein extraction and RNA isolation. Tissue processing in the participating clinical centers involved in this study was performed using standardised protocols. Tissues were frozen in liquid nitrogen and stored at −80 °C until extraction of matched RNA samples.

2.2. Placental explant culture 

First trimester placental explant cultures were established from first trimester human placental tissues with a modification of the method of Genbacev et al. [24]. Placental tissue was washed in ice-cold PBS (Invitrogen, Carlsbad, California), and amnion and umbilical cord were dissected away. Small fragments of placental villi were dissected from the placenta, teased apart, and selected for the presence of trophoblast cell columns. Placental explants were placed in Millicell-CM culture dish inserts (pore size 0.4 μm, Millipore Corporation, Bedford, Massachusetts) precoated with 0.2 ml undiluted phenol red-free matrigel (Becton Dickinson, Bedford, Massachusetts). Explants (n = 3–7) were cultured in 10% FBS DMEM/F-12 media (Invitrogen) supplemented with 100 μg/ml Normocin at 37 °C, 5% CO2 in an atmosphere of 3% O2 for low oxygen treatment and for control in 20% O2. Placental explants were maintained in culture for up to 7 days. The well-characterized pharmacological LXR agonist T0901317 (Cayman Chemicals, Ann Arbor, Michigan) was used in concentrations tested in pilot studies with JAr cells under culture conditions described below. The explants were incubated for 1 week under 3% O2 with and without 1 μM T0901317 (Cayman Chemicals, Ann Arbor, Michigan).

2.3. Cell line and culture 

Cell culture studies were performed with the human choriocarcinoma cell line JAr purchased from the American Type Culture Collection (ATCC; Manassas, VA). Cells were cultured as recommended by ATCC. For our experiments cells were cultured at 37 °C, 5% CO2 in an atmosphere of 1% O2 for low oxygen treatment and for control in 20% O2. For the treatment with T0901317, cells were incubated for 24 h under 20% O2 and 1% O2 with and without 1 μM T0901317 and mRNA was isolated.

2.4. RNA isolation and PCR procedures 

Total RNA was extracted from frozen tissues with TriReagent (Sigma, St. Louis, MO), and quantified using a NanoDrop ND1000 spectrophotometer (NanoDrop Technologies Inc., Wilmington, DE). cDNA synthesis was performed using recombinant M-MLV reverse transcriptase (10 U/μl), the appropriate buffer, dNTPs (500 μmol/L), random nonamers (1 μmol/L), RNAse inhibitor (2U/μl; all from Sigma) and total RNA (50 ng/μL). The reaction mix was incubated for 10 min at 25 °C for primer annealing, 60 min at 37 °C for synthesis and 5 min at 94 °C to denature the RT enzyme. Real-time quantitative PCR was performed using an Applied Biosystems 7900HT FAST sequence detector and Applied Biosystems reagents according to the manufacturer’s instructions. Primers and probes were obtained from Invitrogen. All primer sequences and accession numbers are shown in Table 1. Expression levels were normalized to those of 18S ribosomal RNA or β-actin which was analyzed in separate runs. Both housekeeping genes were constitutively expressed under all conditions of this study.

2.5. Immunoblotting 

Protein extracts were prepared from placental tissues by homogenization with modified RIPA lysis buffer (50 mM Tris/HCl, 150 mM NaCl, 1% NP-40, 0.25% Na-deoxycholate, 1 mM EDTA) supplemented with EDTA free Complete protease inhibitors (Roche, Penzberg, Germany). Protein content was determined using the BCA protein assay (Perbio Science, Bonn, Germany). Protein samples (30 μg) were separated on a 7% polyacrylamide gel and electrophoretically transferred to polyvinylidene difluoride membrane (Amersham Biosciences, US). Membranes were blocked with 5% non-fat dried milk in Tris-buffered saline (TBS) with 0.15% Tween-20 and incubated with the primary antibody. The following primary antibodies were used: rabbit polyclonal anti-ABCA1 (1:1000, Novus Biologicals, Cambridge, UK) and rabbit polyclonal anti-actin (1:600, Sigma–Aldrich, Germany) for normalization of protein expression. Primary antibody binding was detected using the following secondary antibodies: anti-rabbit IgG antibody conjugated to horseradish peroxidase (1:10000; Santa Cruz Biotechnologies, Heidelberg, Germany). Detection was achieved with the ECL chemiluminescence kit (Amersham Biosciences, US) according to the protocol using X-ray films (Kodak, Stuttgart, Germany). Densitometric analysis was performed using Gel Imager (Intas, Goettingen, Germany) and the GELSCAN Pro. V4.0 software (BioSciTec, Frankfurt, Germany). The expression of each signal was normalized to the according actin signal. For each experimental approach a minimum of three independent experiments were performed.

2.6. Immunohistochemistry 

Paraffin sections of four different placentae for each experimental group were cut to a thickness of 7 μm and mounted on protein coated glass slides. After dewaxing in xylene, rehydration in a series of alcohols and fixation in 4% PFA, the antigen retrieval was performed in 0.01M Na-citrate buffer (pH 6)/0.5% Tween-20 in the microwave. To unmask the antigens, the tissue slides were washed in 0.1% Triton X-100 in PBS for 10 min. The nonspecific binding sites were blocked with Dako Protein Blocking solution (Dako) for 1 h. This was followed by incubation with the primary antibodies: rabbit polyclonal anti-ABCA1 (1:100, Abcam, Cambridge, UK), mouse monoclonal anti-LXRA (1:50; Abcam), monoclonal mouse anti-CD34 (1:50, Dako), rabbit polyclonal anti-CD34 (1:50, Santa Cruz) and mouse monoclonal anti-CD163 (1:50, HyCult Biotechnology, NL). Negative controls were performed by omission of the primary antibody. The following appropriate secondary antibodies were used: donkey anti-rabbit Alexa 488® (1:300, MoBiTech, Goettingen, Germany) and Cy3-conjugated donkey anti-mouse (1:200, Dianova, Munich, Germany). After immunolabeling the DNA-specific dye 4′,6′-diamidino-2-phenylindole hydrochloride (DAPI, SIGMA–Aldrich) (0.1 μg/ml; 15 min, 37 °C) was used to counterstain the nuclei.

The sections were mounted with Mowiol (SIGMA–Aldrich) and were studied using a confocal laser scanning microscope (LSM 510, Zeiss, Oberkochen, Germany).

2.7. Statistics 

Statistical analyses were performed using SPSS 16.0 for Windows (SPSS Inc., Chicago, USA). Differences between the groups were analyzed by Kruskal Wallis test followed by Mann–Whitney-U-test. The Wilcoxon Signed Ranks test was used for pairwise comparison of placental explants. Data presented are means ± SD. A p-value ≤ 0.05 was considered statistically significant.

Back to Article Outline

3. Results 

3.1. LXR alpha and beta and their target genes increased in the human placenta during gestation 

In the human placenta, both LXRA and LXRB can be detected throughout gestation. In Fig. 1a and b, mRNA expression is lowest in the first and second trimester of pregnancy (25 and 24% of term for LXRA, 33 and 16% for LXRB, respectively). Expression levels in preterm and term placentae are similar to each other, but significantly higher than in the first two trimesters of gestation (p < 0.05). The obligate heterodimeric partner of the LXRs, RXR, was found to be constitutively expressed throughout gestation (Supplementary Fig. 1). Fig. 1c–g presents the developmental changes of gene expression levels of key genes involved in cellular cholesterol uptake and secretion in the human placenta. Expression of the gene encoding the HDL receptor SRBI is lowest in the first and second trimester and highest in preterm and term placenta (Fig. 1c). The gene encoding the LDL receptor, LDLR, is expressed at constant levels throughout gestation, with a reduced expression in the second trimester (Fig. 1d). The LXR target genes ABCG1 and ABCA1, encoding proteins which are involved in cholesterol excretion, show expression patterns very similar to those of the LXRs, with significant increased expression levels from 2nd trimester to preterm of gestation (Fig. 1e and f). Finally, the LXR target gene encoding the ABC transporter ABCG4 (Fig. 1g) and the cholesterol acceptor APOA1 (Supplementary Fig. 1) are constitutively expressed during gestation.

  • View full-size image.
  • Fig. 1 

    Expression of LXRA and LXRB and their target genes for cholesterol transport are increased in the human placenta during pregnancy. (a–g) Bars show mRNA expression normalized to 18S rRNA in placental tissues of all trimesters of pregnancy. a, LXRA; b, LXRB; c, SRBI; d, LDLR; e, ABCG1; f, ABCA1; g, ABCG4. * denotes significant difference to the preceding age group (p ≤ 0.05; n = 6–10).

3.2. ABCA1 mRNA is significantly increased in early-onset preeclamptic placentae 

The mRNA expression of LXR, their target genes and other key genes involved in cholesterol metabolism was compared between early-onset preeclamptic and age-matched normal control placentae (29.0 ± 1.7 vs 28.8 ± 2.9 weeks of gestation). The expression level of LXRA (Fig. 2a) and LXRB (data not shown) was not significantly different between normal and preeclamptic placentae. Interestingly, the expression of ABCA1 was almost twofold increased in early-onset preeclampsia, although with notable variation (P = 0.025; Fig. 2a). Furthermore no differences in expression levels of genes involved in cholesterol metabolism (SREBP1A and 1C, ABCG1, ABCG4, LDLR, FASN, SRB1, and APOA) were found (data not shown).

  • View full-size image.
  • Fig. 2 

    LXRA and ABCA1 mRNA expression in human placentae of preeclamptic patients compared to age-matched normal controls. a, mRNA expression of LXRA and ABCA1 in early-onset preeclamptic placentae (25–33 wk, n = 16) and their respective gestational age-matched controls (23–33 wk, n = 16); b, mRNA expression of LXRA and ABCA1 in late-onset preeclamptic placentae (34–39 wk, n = 15) and gestational age-matched control groups (control 2: 34–39 wk, n = 12). * indicates significant difference compared to control (MWU-test, p ≤ 0.05). - indicates the average per group.

In late-onset preeclampsia (week 34–39 of gestation), the expression levels of LXRA or ABCA1 were not significantly different (Fig. 2b) from age-matched controls. Similarily to the early-onset preeclampsia samples the transcript levels obtained for LXRB, SREBP1A, SREBP1C, ABCG1, ABCG4, LDLR, FASN, SRB1 and APOA1 did not change in late-onset preeclampsia (data not shown).

3.3. LXRA and ABCA1 protein expression increased in the human placenta during gestation and ABCA1 protein expression is increased in early preeclamptic placentae 

Since it is known that LXRA in contrast to LXRB is expressed in a tissue-specific manner, is required for cholesterol metabolism in the liver and seems to have a higher activity in regulating the target genes we focus here on the expression of LXRA [2], [4].

Fig. 3 shows the immunohistochemical localization of LXRA and ABCA1 protein in villous placental tissues from different gestational ages of uncomplicated pregnancies. In 8 week first trimester human placenta LXRA is strongly localized in the cytotrophoblast (CT) compared to a weaker staining in the syncytiotrophoblast (ST) (Fig. 3a). However, in second trimester placental tissue the expression of LXRA is enhanced but shifted from the trophoblast to the mesenchyme (Fig. 3c). In term placental tissue (38 wk) LXRA is mainly expressed in endothelium of vessels as shown by co-labeling with the endothelial cell marker CD34 (Fig. 3b).

  • View full-size image.
  • Fig. 3 

    LXRA and ABCA1 expression increased in the human placenta during gestation and ABCA1 protein expression is increased in early preeclamptic placentae. (a–c) Localization of LXRA (green) in human placental tissue of 1st trimester (8 wk, a), 2nd trimester (30 wk, c) and term placenta (38 wk, b). LXRA is mainly expressed in the cytotrophoblast, mesenchyme and endothelial cells of vessels as shown by co-localization with CD34 (red) (b). (e–g) Localization of ABCA1 (green) in human placental tissue in 1st trimester (8 wk, e), 2nd trimester (30 wk, g) and term placenta (38 wk, f). ABCA1 is expressed in the syncytiotrophoblast, cytotrophoblast, mesenchyme and endothelial cells of vessels as shown by co-localization with CD34 (red) (f) and placental macrophages (Hofbauer cells) co-labeled with the marker CD163 (red) (insert in f). (b, f) + DAPI staining of the nuclei (blue). yellow staining: merge. Localization of LXRA protein in age-matched normal control placental tissue (30 wk) (c) compared to early-onset preeclamptic placentae (early Pe, 30 wk) (d) showed no change in expression and localization. Interestingly localization of ABCA1 protein in early-onset preeclamptic placentae (31 wk, h) showed a stronger expression in the mesenchyme compared to matched control tissue (g). N = 4 different placentae of each experimental group. (i) Example of an immunoblot of ABCA1 expression in early-onset preeclamptic placentae (early PE) and matched normal controls. ABCA1 protein expression is significantly increased in preeclamptic placentae (n = 6) compared to age-matched controls (n = 4). * Different from control (p ≤ 0.05). Scale bar represents 80 μm.

ABCA1 is primarily expressed in ST and CT cells in the first trimester placenta (Fig. 3e). In 2nd trimester (26th week) (Fig. 3g) and term placental tissue (Fig. 3f; 38 wk) the level of ABCA1 protein is increased and like LXRA its expression is shifted to the mesenchymal and endothelial cells - as shown by double-immunolabeling with CD34 in the term placenta (Fig. 3f). In addition ABCA1 expression is found in fetal macrophages, called Hofbauer cells, as confirmed by co-localization with the marker CD163 (Fig. 3f, insert).

The increase in ABCA1 protein in early preeclamptic placentae compared to age-matched controls was shown by immunohistochemistry (Fig. 3g and h). ABCA1 expression increased mainly in the mesenchymal cells, vessels and macrophages of preeclamptic placentae. More convincingly this increase was confirmed by immunoblotting that demonstrated a 220 kDa band corresponding to ABCA1 (Fig. 3i) (2.6fold on average, P ≤ 0.05). No differences in LXRA localization and protein expression could be detected using immunohistochemistry comparing severe early preeclamptic with healthy control placentae as shown in Fig. 3c and d as well as by immunoblotting (data not shown).

Taken together, from all investigated target genes involved in cholesterol metabolism only ABCA1 was elevated in early-onset preeclampsia without an elevation of the LXR receptors.

3.4. The expression of LXRA and ABCA1 increased upon low oxygen in JAr trophoblast cells and the LXR pathway is pharmacologically activated 

The choriocarcinoma cell line JAr was used to investigate if a low oxygen environment in preeclampsia influences the LXR pathway. For this reason we cultured JAr cells for 24 h under 1% O2 hypoxia and 20% O2 control conditions. We have chosen 1% O2 for the cell culture experiments because only at 1% O2 we revealed an accumulation of HIF-1α as a hypoxic response in this trophoblast cell line (Gellhaus, unpublished data). The transcript levels of LXRA, LXRB and the prototypical LXR target gene ABCA1 were analyzed after culture for 24h (Fig. 4). All transcripts were significantly elevated upon hypoxia compared to 20% O2 controls. Notably, the increase in LXRA expression upon hypoxia was higher compared to LXRB.

  • View full-size image.
  • Fig. 4 

    Expression of LXRA, LXRB and their target gene ABCA1 in human JAr trophoblast cells treated with and without T0901317 upon normal and low oxygen levels. JAr cells were incubated with or without the LXR agonist T0901317 (1.0 μM) upon 20% O2 and 1% O2 conditions. a, LXRA; b, LXRB; c, ABCA1. mRNA expression was corrected for that of 18S rRNA. * Different from normoxic control (MWU-test, p ≤ 0.05).

To test whether LXR can be activated in human trophoblast cells in a similar way as in the mouse placenta [9], cells were incubated with 1 μM of the synthetic LXR agonist T0901317 mimicking the endogenous ligands or with the solvent only (Fig. 4). A further significant increase of induction of LXRA (Fig. 4a) and strong induction of ABCA1 (Fig. 4c) could be detected upon T0901317 treatment in combination with 1% O2 levels. No significant change was observed analyzing LXRB comparing T0901317 treatment under 1% O2 with 20% O2 (Fig. 4b).

3.5. The expression of LXRA and ABCA1 increased upon low oxygen in human placental explants and the LXR pathway is pharmacologically activated 

To investigate whether the observed increase in ABCA1 expression is related to the low oxygen environment in the placenta, we cultured human placental explants under conditions of high (20%) and low (3%) oxygen. As shown in Fig. 5c, in 6 out of 7 individual explants from different donors ABCA1 mRNA levels were increased by hypoxia (2.2-fold on average, P = 0.047). Interestingly, as depicted in Fig. 5a and b, in contrast to ABCA1 the mRNA expression levels of LXRA and LXRB were not significantly altered upon hypoxia in 5–6 explants studied, from different placentae, although a trend to a reduced expression upon hypoxia was observed.

  • View full-size image.
  • Fig. 5 

    ABCA1 mRNA expression in human placental explants is increased upon low oxygen, while LXRA and LXRB are unchanged. Human placental explants from 7 different donors were incubated under 20% O2 and hypoxic conditions (3% O2). mRNA expression of LXRA (a), LXRB (b) and ABCA1 (c) was corrected for that of β-actin. Data were analyzed in a pairwise way by Wilcoxon Signed Ranks Test.

Moreover, we incubated human placental explants from first trimester pregnancies under 3% O2 hypoxia with the LXR agonist T09013171 (1 μM) and measured mRNA expression of ABCA1. As depicted in Fig. 6, expression of ABCA1 varied considerably between the parallel experiments, maybe due to the few samples measured, however ABCA1 was on average 6 times higher in T0901317-treated explants compared to controls (p = 0.029, single-sided Mann–Whitney U test).

  • View full-size image.
  • Fig. 6 

    ABCA1 mRNA expression in human placental explants is increased upon T0901317 treatment under 3% O2. Human placental explants were treated with 1 μM T0901317 (n = 4) upon 3% O2 compared to the untreated control (n = 3). Data were analyzed by MWU, single-sided significance.

To summarize, this study showed for the first time the defined temporal and spatial expression pattern of LXRA and its target gene ABCA1 in the human placenta. The expression levels of both members of the maternal-fetal cholesterol transport system are increased from 2nd trimester onwards. Interestingly, ABCA1 is increased in early preeclamptic placentae probably upon a low oxygen environment as shown in first trimester explants and JAr trophoblast cells cultured under low oxygen and enhanced by the LXR agonist T0901317.

Back to Article Outline

4. Discussion 

Cholesterol transfer to plasma lipoproteins is generally believed to rely on the ABC-transporters ABCA1 and ABCG1 [26]. ABCA1 is responsible for transfer of cholesterol to nascent HDL, whereas ABCG1 is involved in cholesterol transport to mature HDL.

In mice the functional importance of ABCA1 transporter for embryo development has been impressively shown by the loss of the ABCA1 gene which caused severe placental malformation resulting in severe embryo growth retardation, fetal loss and neonatal death [27].

Epidemiological studies in humans have provided evidence that maternal hypercholesterolemia is associated with the development of atherosclerotic lesion in the fetus [30], [31]. Therefore, in our current study we analyzed the expression pattern of LXRA and LXRB and their target genes of maternal-fetal cholesterol transport during fetal development in the human placenta. We here demonstrate that both LXRA and LXRB are expressed throughout gestation, but in significant higher levels in the third trimester. Thereby we confirmed and extended the data from Bhattacharjee and colleagues who have demonstrated that the LXR target ABCA1 is expressed in human placentae of the first and last trimester of pregnancy [32]. Moreover we found in addition to ABCA1 and ABCG1, another transporter putatively involved in transport of cholesterol and other sterols, ABCG4 which is however not significantly regulated in pregnancy or altered in preeclampsia and its function remains elusive [28], [29].

LXRA and ABCA1 are mainly localized in the villous trophoblast and in endothelial vessels. We assume that this expression pattern provides a means to adapt the maternal-fetal cholesterol supply to the demands of the growing fetus. This hypothesis was strengthened by the finding of a shift in localization of LXRA and ABCA1 from the trophoblast to the mesenchymal/vessel compartment in the villous placental tissue during pregnancy. We further demonstrated that the LXR system is indeed functional in these human trophoblast cells as shown by activation of the ABCA1 transporter with the pharmacological LXR agonist T0901317 in JAr trophoblast cells as well as in placental explants.

As maternal predisposing factors such as diabetes and obesity contribute to the development of preeclampsia and cholesterol transport may be changed in a hypoxic environment, we investigated whether maternal-fetal cholesterol transport would be affected in preeclamptic placentae. In early-onset preeclamptic samples compared to normal age-matched controls ABCA1 is significantly increased whereas in late-onset preeclampsia only a slight but not significant elevation of ABCA1 was found. These observations correlate in part with the study of Albrecht et al. who did not detect changes in ABCA1 levels by placentae from women suffering predominantly from late-onset preeclampsia [33]. Our data further supports the placental etiology of severe early-onset disease versus the maternal causes of late-onset preeclampsia suggested by Redman and Sargent [34].

We demonstrated that both LXRA and LXRB are regulated by low oxygen tension in a trophoblast cell line, but surprisingly not in the explants studied. In the cell line, we revealed a higher expression of LXRA compared to LXRB upon hypoxia which was further elevated upon additional treatment with T0901317. These elevated levels correlate to increased expression of ABCA1 involved in cholesterol transfer suggesting a more potent role of LXRA in cholesterol metabolism in the human placenta. In contrast to the trophoblast cell line, in the placental explants we found decreased levels of LXRA and LXRB but a significant, although highly variable, increased level of ABCA1 upon hypoxia. This might be explained by the fact that the explant tissue – in contrast to the trophoblast cell line - contains a stromal compartment which participates in the expression of LXRA and ABCA1 with ongoing pregnancy.

Moreover, our observation that the expression of ABCA1 is consistently regulated by oxygen tension while the expression of the LXRs shows high variability might indicate that upon hypoxia LXR-independent factors such as HIF-1beta may overrule the classical regulation of ABCA1. Indeed, Ugocsai et al. described that HIF-1beta, the heterodimeric partner of the oxygen-sensitive HIF-1alpha, functions as a master regulator of ABCA1 expression, by binding in the ABCA1 promoter and regulating cholesterol efflux under hypoxic conditions in primary human macrophages [35]. In human placenta where HIF plays a pivotal role for adaptation to a hypoxic environment [36], ABCA1 shows a strong correlation with HIF-1beta upregulation in early-onset preeclamptic placentae but not in placentae of normal pregnancies [35].

An increase in LXRA receptor and ABCA1 transporter levels point to an important role of ligands such as the oxysterols, which may be increased in preeclampsia. Moreover, in the preeclamptic placentae we found only an activation of ABCA1 but not of other target genes involved in cholesterol metabolism. This again points to an at least partial LXR-independent regulation of ABCA1 under pathophysiological conditions. It is possible that this novel mechanism represents a balance that can overcome the excess in cholesterol derivatives as an upregulation of ABCA1 would result in increased cholesterol efflux in the placental tissue.

However, the physiological relevance of increased levels of ABCA1 expression observed in preeclamptic placentae and hypoxic placental explants for maternal-fetal cholesterol transport and trophoblast invasion clearly needs further investigation. We have previously postulated that LXR-dependent processes may be involved in maternal-fetal cholesterol transport [7] which has been confirmed by studies in specific mouse models [9]. In the current study we have demonstrated that these observations most likely can be transferred to the human situation but may be influenced by independent factors. One consequence of the increased level of ABCA1 in preeclampsia could be an excess of cholesterol transported to the fetus which may have physiological consequences. Overall, our study provides new insights into LXR and ABCA1 regulation in the human placenta and sheds light on the placenta-mediated manipulation of maternal-fetal cholesterol transport. This new information may provide targeted opportunities to influence maternal-fetal cholesterol transport and thereby ultimately protect the fetus from the deleterious effects of maternal hypercholesterolemia.

Back to Article Outline

Authors’ contributions 

T.P., A.G, F.K. and E.W. designed research; E.v.S., N.W., N.H., A.G. and T.P. performed research; A.G. and T.P. analyzed data; M.S. and C.D. contributed materials and discussed data; T.P., A.G., and E.W. wrote the paper.

Back to Article Outline

Funding 

Supported by a Dr. Dekker fellowship of the Netherlands Heart Foundation (grant 2004T048) to T.P and by grants from the German Research Foundation (DFG: Wi 774/21–2; Wi 774/22-2) to A.G., N.W. and E.W.

Back to Article Outline

Acknowledgements 

We thank Juul F.W. Baller for excellent technical assistance.

Back to Article Outline

Appendix A. Supplementary material 

Download file

download text

Back to Article Outline

References 

  1. Peet DJ, Turley SD, Ma W, Janowski BA, Lobaccaro JM, Hammer RE, et al. Cholesterol and bile acid metabolism are impaired in mice lacking the nuclear oxysterol receptor LXR alpha. Cell. 1998;93:693–704
  2. Zhao C, Dahlman-Wright K. Liver X receptor in cholesterol metabolism. J Endocrinol. 2010;204:233–240
  3. Oosterveer MH, Grefhorst A, Groen AK, Kuipers F. The liver X receptor: control of cellular lipid homeostasis and beyond: implications for drug design. Prog Lipid Res. 2010;
  4. Korach-Andre M, Parini P, Larsson L, Arner A, Steffensen KR, Gustafsson JA. Separate and overlapping metabolic functions of LXR{alpha} and LXR{beta} in C57Bl/6 female mice. Am J Physiol Endocrinol Metab. 2010;298:E167–E178
  5. Bischoff ED, Daige CL, Petrowski M, Dedman H, Pattison J, Juliano J, et al. Non-redundant roles for LXRalpha and LXRbeta in atherosclerosis susceptibility in low density receptor knockout mice. J Lipid Res. 2009;[PMID: 19329817]
  6. Pavan L, Hermouet A, Tsatsaris V, Therond P, Sawamura T, Evain-Brion D, et al. Lipids from oxidized low-density lipoprotein modulate human trophoblast invasion: involvement of nuclear liver X receptors. Endocrinology. 2004;145:4583–4591
  7. Plösch T, van Straten EM, Kuipers F. Cholesterol transport by the placenta: placental liver X receptor activity as a modulator of fetal cholesterol metabolism?. Placenta. 2006;28:604–610
  8. Tint GS, Yu H, Shang Q, Xu G, Patel SB. The use of the Dhcr7 knockout mouse to accurately determine the origin of fetal sterols. J Lipid Res. 2006;47:1535–1541
  9. Lindegaard ML, Wassif CA, Vaisman B, Amar M, Wasmuth EV, Shamburek R, et al. Characterization of placental cholesterol transport: ABCA1 is a potential target for in utero therapy of smith-lemli-opitz syndrome. Hum Mol Genet. 2008;17:3806–3813
  10. Furuhashi M, Seo H, Mizutani S, Narita O, Tomoda Y, Matsui N. Expression of low density lipoprotein receptor gene in human placenta during pregnancy. Mol Endocrinol. 1989;3:1252–1256
  11. Wyne KL, Woollett LA. Transport of maternal LDL and HDL to the fetal membranes and placenta of the Golden Syrian hamster is mediated by receptor-dependent and receptor-independent processes. J Lipid Res. 1998;39:518–530
  12. Hatzopoulos AK, Rigotti A, Rosenberg RD, Krieger M. Temporal and spatial pattern of expression of the HDL receptor SR-BI during murine embryogenesis. J Lipid Res. 1998;39:495–508
  13. Wadsack C, Hammer A, Levak-Frank S, Desoye G, Kozarsky KF, Hirschmugl B, et al. Selective cholesteryl ester uptake from high density lipoprotein by human first trimester and term villous trophoblast cells. Placenta. 2003;24:131–143
  14. Langmann T, Mauerer R, Zahn A, Moehle C, Probst M, Stremmel W, et al. Real-time reverse transcription-PCR expression profiling of the complete human ATP-binding cassette transporter superfamily in various tissues. Clin Chem. 2003;49:230–238
  15. Nishimura M, Naito S. Tissue-specific mRNA expression profiles of human ATP-binding cassette and solute carrier transporter superfamilies. Drug Metab Pharmacokinet. 2005;20:452–477
  16. Hawfield A, Freedman BI. Pre-eclampsia: the pivotal role of the placenta in its pathophysiology and markers for early detection. Ther Adv Cardiovasc Dis. 2009;3:65–73
  17. Sibai B, Dekker G, Kupferminc M. Pre-eclampsia Lancet. 2005;365:785–799
  18. Myatt L. Role of placenta in preeclampsia. Endocrine. 2002;19:103–111
  19. Genbacev O, Joslin R, Damsky CH, Polliotti BM, Fisher SJ. Hypoxia alters early gestation human cytotrophoblast differentiation/invasion in vitro and models the placental defects that occur in preeclampsia. J Clin Invest. 1996;97:540–550
  20. Genbacev O, Zhou Y, Ludlow JW, Fisher SJ. Regulation of human placental development by oxygen tension. Science. 1997;277:1669–1672
  21. Fisher SJ. The placental problem: linking abnormal cytotrophoblast differentiation to the maternal symptoms of preeclampsia. Reprod Biol Endocrinol. 2004;2:53
  22. Atkinson KR, Blumenstein M, Black MA, Wu SH, Kasabov N, Taylor RS, et al. An altered pattern of circulating apolipoprotein E3 isoforms is implicated in preeclampsia. J Lipid Res. 2009;50:71–80
  23. Gellhaus A, Schmidt M, Dunk C, Lye SJ, Kimmig R, Winterhager E. Decreased expression of the angiogenic regulators CYR61 (CCN1) and NOV (CCN3) in human placenta is associated with pre-eclampsia. Mol Hum Reprod. 2006;12:389–399
  24. Genbacev O, Schubach SA, Miller RK. Villous culture of first trimester human placenta–model to study extravillous trophoblast (EVT) differentiation. Placenta. 1992;13:439–461
  25. Stefulj J, Panzenboeck U, Becker T, Hirschmugl B, Schweinzer C, Lang I, et al. Human endothelial cells of the placental barrier efficiently deliver cholesterol to the fetal circulation via ABCA1 and ABCG1. Circ Res. 2009;104:600–608
  26. Plösch T, Kosters A, Groen AK, Kuipers F. The ABC of hepatic and intestinal cholesterol transport. Handb Exp Pharmacol. 2005;170:465–482
  27. Christiansen-Weber TA, Voland JR, Wu Y, Ngo K, Roland BL, Nguyen S, et al. Functional loss of ABCA1 in mice causes severe placental malformation, aberrant lipid distribution, and kidney glomerulonephritis as well as high-density lipoprotein cholesterol deficiency. Am J Pathol. 2000;157:1017–1029
  28. Wang N, Yvan-Charvet L, Lütjohann D, Mulder M, Vanmierlo T, Kim TW, et al. ATP-binding cassette transporters G1 and G4 mediate cholesterol and desmosterol efflux to HDL and regulate sterol accumulation in the brain. FASEB J. 2008;22:1073–1082
  29. Bojanic DD, Tarr PT, Gale GD, Smith DJ, Bok D, Chen B, et al. Differential expression and function of ABCG1 and ABCG4 during development and ageing. J Lipid Res. 2009;51:169–181
  30. Napoli C, Glass CK, Witztum JL, Deutsch R, D’Armiento FP, Palinski W. Influence of maternal hypercholesterolaemia during pregnancy on progression of early atherosclerotic lesions in childhood: Fate of Early Lesions in Children (FELIC) study. Lancet. 1999;354:1234–1241
  31. Napoli C, D’Armiento FP, Mancini FP, Postiglione A, Witztum JL, Palumbo G, et al. Fatty streak formation occurs in human fetal aortas and is greatly enhanced by maternal hypercholesterolemia. Intimal accumulation of low density lipoprotein and its oxidation precede monocyte recruitment into early atherosclerotic lesions. J Clin Invest. 1997;100:2680–2690
  32. Bhattacharjee J, Ietta F, Giacomello E, Bechi N, Romagnoli R, Fava A, et al. Expression and localization of ATP binding cassette transporter A1 (ABCA1) in first trimester and term human placenta. Placenta. 2010;31:423–430
  33. Albrecht C, Soumian S, Tetlow N, Patel P, Sullivan MH, Lakasing L, et al. Placental ABCA1 expression is reduced in primary antiphospholipid syndrome compared to pre-eclampsia and controls. Placenta. 2007;28:701–708
  34. Redman CW, Sargent IL. Latest advances in understanding preeclampsia. Science. 2005;308:1592–1594
  35. Ugocsai P, Hohenstatt A, Paragh G, Liebisch G, Langmann T, Wolf Z, et al. HIF-1beta determines ABCA1 expression under hypoxia in human macrophages. Int J Biochem Cell Biol. 2010;42:241–252
  36. Caniggia I, Winter JL. Adriana and Luisa Castellucci Award lecture 2001. Hypoxia inducible factor-1: oxygen regulation of trophoblast differentiation in normal and pre-eclamptic pregnancies–a review. Placenta. 2002;23(Suppl. A):S47–S57

PII: S0143-4004(10)00278-X

doi:10.1016/j.placenta.2010.07.009

Placenta
Volume 31, Issue 10 , Pages 910-918, October 2010

Article Tools

* Image Usage & Resolution