Placenta
Volume 31, Issue 10 , Pages 902-909, October 2010

Maternal undernutrition alters fat cell size distribution, but not lipogenic gene expression, in the visceral fat of the late gestation guinea pig fetus

  • L.T. Nguyen

      Affiliations

    • Early Origins of Adult Health Research Group, Sansom Institute for Health Research, School of Pharmacy and Medical Sciences, University of South Australia, Adelaide, SA 5001, Australia
  • ,
  • B.S. Muhlhausler

      Affiliations

    • Early Origins of Adult Health Research Group, Sansom Institute for Health Research, School of Pharmacy and Medical Sciences, University of South Australia, Adelaide, SA 5001, Australia
    • Present address: FOODplus Research Centre, School of Agriculture, Food and Wine, The University of Adelaide, Adelaide, SA 5064, Australia.
  • ,
  • K.J. Botting

      Affiliations

    • Early Origins of Adult Health Research Group, Sansom Institute for Health Research, School of Pharmacy and Medical Sciences, University of South Australia, Adelaide, SA 5001, Australia
    • Discipline of Physiology, School of Medical Sciences, Faculty of Health Sciences, The University of Adelaide, Adelaide, SA 5005, Australia
  • ,
  • J.L. Morrison

      Affiliations

    • Early Origins of Adult Health Research Group, Sansom Institute for Health Research, School of Pharmacy and Medical Sciences, University of South Australia, Adelaide, SA 5001, Australia
    • Discipline of Physiology, School of Medical Sciences, Faculty of Health Sciences, The University of Adelaide, Adelaide, SA 5005, Australia
    • Corresponding Author InformationCorresponding author at: Sansom Institute for Health Research, School of Pharmacy and Medical Sciences, University of South Australia, GPO Box 2471, Adelaide, SA 5001, Australia. Tel.: +61 8 8302 2166; fax: +61 8 8302 2389.

Accepted 27 July 2010. published online 23 August 2010.

Article Outline

Abstract 

This study investigated the development of adipose tissue in the guinea pig and the impact of maternal undernutrition on the structural and functional characteristics of perirenal adipose tissue in the dam and fetus. Date-mated guinea pigs were provided with either ad libitum feed (Control, C) or 85% of food intake per body weight of the Controls (Undernutrition, UN). Maternal (C, n = 6; UN, n = 7) perirenal adipose tissue (PAT) was collected at 60 d gestation and fetal PAT was collected at 50 d (C, n = 4) and 60 d (C, n = 8 and UN, n = 7) gestation (term, 69 d). The expression of stearoyl-CoA desaturase (SCD-1), fatty acid synthase (FAS), lipoprotein lipase (LPL), leptin and glycerol 3 phosphate dehydrogenase (G3PDH) mRNA and glucose transporters 1 and 4 (GLUT1 and GLUT4) was determined by Real Time PCR. There was no effect of maternal UN on total or relative PAT mass in the pregnant dam. There was an increase in G3PDH, but not LPL, leptin, FAS or GLUT4 mRNA expression, in UN dams compared to Controls (P < 0.05). In the fetal guinea pig there was no effect of maternal UN on total or relative PAT mass, however, the UN fetuses had a higher percentage of larger lipid locules in their PAT compared to Controls (P < 0.05). The expression of FAS, LPL, SCD-1, leptin, G3PDH and GLUT4 mRNA in PAT was not different between the Control and UN fetuses. These results support previous studies which have demonstrated that maternal undernutrition is associated with an increased accumulation of visceral adipose tissue in utero, and extend them by showing that maternal undernutrition results in early changes in the size distribution of lipid locules in visceral fat depots that precede changes in lipogenic gene expression.

Keywords: Maternal undernutrition, Adipose tissue, Gene expression, Obesity, Guinea pig, Fetus

 

Back to Article Outline

1. Introduction 

A worldwide series of epidemiological, clinical and experimental studies have demonstrated that exposure to a suboptimal nutrient supply before birth is associated with an increased risk of obesity and type 2 diabetes in later life [1], [2], [3], [4], [5]. Individuals who are exposed to a poor nutrient supply during fetal life are lighter and thinner at birth, but go on to accumulate increased amounts of visceral adipose tissue in early childhood [5], [6]. This increased fat deposition is a feature of the thrifty phenotype [7], which results in an enhanced capacity of individuals who are small for their gestational age to store adipose tissue, particularly in visceral fat depots, in postnatal life [8]. When these individuals encounter a postnatal environment that is nutrient rich, increased deposition of visceral fat may occur and this is associated with metabolic defects, including impaired insulin sensitivity and the development of type 2 diabetes [7]. It has therefore been proposed that exposure to a reduced supply of nutrients during critical windows of development results in changes in the structural and functional characteristics of the visceral adipocyte which, in turn, result in an increased accumulation of visceral adipose tissue in postnatal life.

As in the human, the fetal guinea pig accumulates appreciable fat depots before birth [9]. Previous studies have shown that maternal undernutrition in the guinea pig is associated with the development of increased visceral adiposity and reduced glucose tolerance in adult male offspring [10]. Furthermore, Kind and colleagues have previously reported that exposure to maternal undernutrition is associated with an increase in the size of lipid locules present in the perirenal adipose depot in the late gestation guinea pig fetus [11]. This suggests that exposure to a suboptimal nutrient supply in utero is associated with altered development of the visceral adipose tissue before birth. In addition, these data suggest that maternal undernutrition may activate lipogenesis in fetal life, resulting in increased adiposity in adult life.

In postnatal life, the transcription factor sterol regulatory element binding protein-1c (SREBP-1c) is the master regulator of lipogenesis. It promotes fat storage by increasing the transcription of the key lipogenic enzymes, stearoyl coA desaturase 1 (SCD-1), fatty acid synthase (FAS), glycerol 3 phosphate dehydrogenase (G3PDH) and lipoprotein lipase (LPL) [9], [12]. FAS is involved in the de novo synthesis of fatty acids; G3PDH catalyzes key steps in the synthesis of triglycerides, the storage form of lipid in adipose tissue, from glycerol and free fatty acids, whilst LPL increases the uptake of free fatty acids from the circulation, which can then be utilized as substrate for triglyceride synthesis [13]. The insulin independent (GLUT1) and insulin-dependent (GLUT4) glucose transporters also play an important role in the regulation of lipogenesis by controlling the entry of glucose into the adipocyte, where it is utilized for de novo fatty acid and triglyceride synthesis [13]. In adult life, expression and activity of adipocyte genes is regulated by nutritional status; expression of SREBP-1c is increased in response to insulin and glucose, and decreased in response to low nutrient concentrations [9], [12].

There are few studies which have investigated the impact of low nutrient concentrations before birth on the expression of lipogenic genes in the fetal adipose tissue. We have previously shown that the expression of leptin mRNA in perirenal adipose tissue is reduced in placentally restricted fetal sheep, who are exposed to low concentrations of both glucose and oxygen in late gestation [14]. It is not known, however, whether the expression of the genes that regulate lipogenesis is increased in response to a reduced nutrient supply in utero or if changes in gene expression precede changes in adiposity. In the present study we have investigated the hypotheses that, firstly, genes known to regulate lipogenesis in postnatal life are expressed in the adipose depots of the guinea pig before birth, as in the human, rat and sheep and, secondly, that maternal undernutrition results in increased expression of genes which regulate lipid storage and substrate uptake within the major visceral adipose depot in the late gestation fetal guinea pig.

Back to Article Outline

2. Materials and methods 

2.1. Animals and feeding regimen 

All procedures were conducted with the approval of the IMVS/UniSA and University of Adelaide Animal Ethics Committee. Adult IMVS/Dunkin Hartley guinea pigs (19 females, and 7 males) were used in this study. The animals were housed individually in cages in a 12/12 light/dark cycle and an ambient temperature of ∼21 °C. All guinea pigs were acclimatised to the Animal Holding Facility and individually housed for 3 weeks prior to the start of the experiment. Following the acclimatisation period, the guinea pigs were randomly assigned to either the Control or Undernutrition groups. Control (C, 12 dams) animals were fed ad libitum with standard laboratory chow (Laucke Mills, Daveyston, Australia). The animals in the Undernutrition group (UN, 7 dams) received 85% of the average daily ad libitum food intake per gram body weight of the Controls for 161 ± 10 d prior to conception. All animals in both the Control and UN groups had ad libitum access to water supplemented with vitamin C (400 mg/l).

Food intake and body weight of each animal was monitored 3 times weekly. Guinea pigs were given a set amount of food on each of these days and the remaining food was weighed on the following occasion. Guinea pigs were also weighed on each of these occasions to allow for the calculation of weight gain. The food intake per gram of body weight was determined in Control guinea pigs using the following equation:

2.2. Mating 

Female guinea pigs were monitored daily for the onset of oestrus. When in oestrus, female guinea pigs were placed in a cage with a proven male for 24 h. The day the female was placed with the male was considered day 0 of gestation.

2.3. Post-mortem and tissue collection 

Pregnant dams were killed with an overdose of sodium pentobarbitone (325 mg/ml Pentobarbitone Sodium, Virbac (Australia) Pty Ltd, Peakhurst, Australia). The uterus was removed and fetal and maternal organs were collected and weighed. The first fetus at the tip of the left horn of the uterus was designated fetus A and was used in this study. Each fetus in this study is from a different pregnancy (Control, 4 fetuses (n = 2 male, n = 2 female) at 48–55 d; 7 fetuses (n = 5 male, n = 2 female) at 59–62 d; UN, 6 fetuses (n = 5 male, n = 1 female) at 59–62 d gestation; term, 69 d). Tissue was also collected from pregnant dams at 59–62 d gestation (Control, n = 6, UN, n = 7). All organs were dissected, weighed and then stored in RNALater at −20 °C for subsequent molecular analyses or fixed in 4% paraformaldehyde in 0.1 M phosphate buffer for subsequent processing and histological analyses. Adipose tissue from the perirenal adipose tissue (PAT), a major visceral fat depot which develops in fetal life in guinea pigs [9], [11], was weighed and collected in order to determine fat mass in each experimental animal. The PAT depot was also weighed and collected from pregnant dams at 59–62 d gestation (Control, n = 6, UN, n = 7).

2.4. RNA extraction and cDNA synthesis 

RNA was extracted and purified from the maternal and fetal PAT, as previously described [15]. Briefly, ∼100 mg of PAT was homogenised in 1 ml Trizol reagent (Invitrogen Life Technologies, USA) and allowed to stand at room temperature for 5 min. Chloroform (200 μl) was then added, the samples were shaken vigorously for a short period before being incubated at room temperature for approximately 15 min and then centrifuged at 12,000 rpm for 15 min at 4 °C. After centrifugation the upper aqueous phase containing RNA was collected (∼500 μl) and 500 μl of 70% ethanol was added. The RNA was purified using the RNeasy Mini Kit (QIAGEN Pty Ltd-Australia, Doncaster, Australia) according to the manufacturers’ instructions. The purity and concentration of RNA was measured at 260 and 280 nm using a spectrophotometer and the integrity of the RNA was determined using agarose gel electrophoresis. cDNA was then synthesised using the purified RNA (∼2 μg), Superscript 3 reverse transcriptase (Invitrogen Australia Pty Limited, Mount Waverley, Australia) and random hexamers.

2.5. Quantitative Real Time Reverse Transcription-PCR (qRT-PCR) 

The expression of SCD-1, LPL, FAS, leptin, G3PDH, GLUT1 and GLUT4 mRNA was determined in fetuses and dams using the Sybr Green system in the ABI Prism 7300 Sequence Detection System (PE Applied Biosystems, Foster city, CA). Primers were designed using the Primer Express software (PE Applied Biosystems, Foster City, CA) (Table 1). All amplicons were sequenced prior to the experiment to ensure the authenticity of the DNA product and a qRT-PCR melt curve analysis was performed to demonstrate amplicon homogeneity. The absence of genomic contamination in the extracted RNA was verified by including a control in which no reverse transcriptase had been used in the RT reaction. These samples were subsequently subjected to qRT-PCR in order to verify that there was no amplification. The primer concentrations were consistent for all genes, and the r2 for the amplification efficiency of all primers was 0.997–0.999 and at least three technical replicates were performed for each gene. Two quality controls were included on each plate in order to verify inter-plate consistency.

Table 1. Oligonucleotide primer sequences for quantitative Real Time (qRT-PCR) analysis.
GeneForward primer 5′–3′Reverse primer 5′–3′Accession number
Acidic Ribosomal Protein P0CCACCCTGAAGTGCTTGACATAGGCAGATGGATCAGCCABT021080
Sterol co-enzyme desaturase 1 (SCD-1TGGGTTGGCTGCTTGTGGTGTGGGCAGGATGAAGNM_139192
Fatty acid synthase (FAS)TGCTCCCAGCTGCAGGCGCCCGGTAGCTCTGGGTGTANM_017332
Lipoprotein lipase (LPL)CGGTGGCCGAGAGTGAGAGTATGTGTTATTCGCGGACACTTCM15483
Glycerol 3 phosphate dehydrogenase (G3PDH)GCTCATGGAGATGATCGCCTGCTGCTCAATGGACTTTCCBT020681
Glucose transporter 1 (GLUT1)TAACCGCAACGAGGAGAACC3CCACGCAGCTTCTTCAGCAU89029
Glucose transporter 4 (GLUT4)GTGGCCATCTTTGGCTTCGTGCGGCTGAGATCTGGTCAAACAY949177
LeptinACCACCCTGTCCTCCTCACATCTGGAGATTTTCCAGGTCGTT[38]

Each qRT-PCR reaction well (10 μl total volume) contained 6 μl of a 2× Sybr Green Master Mix (PE Applied Biosystems, Foster City, CA); 1 μl of each primer giving a final concentration of 450 or 900 nM, 2.0 μl of molecular grade H20 and 1.0 μl of a 50 ng/μl dilution of the stock template. The cycling conditions consisted of 40 cycles of 95 °C for 15 min and 60 °C for 1 min. At the end of each run dissociation melt curves were obtained.

The abundance of each mRNA transcript was measured and expression relative to that of the housekeeper gene Acidic Ribosomal Protein P0 (RpP0) was calculated using Q-gene qRT-PCR analysis software. This provides a quantitative measure of the relative abundance of a specific transcript in different tissues by the comparative threshold cycle (Ct) method which takes into account any differences in the amplification efficiencies of the target and reference genes. The Ct value was taken as the lowest statistically significant (>10 standard deviation (SD)) increase in fluorescence above the background signal in an amplification reaction.

2.6. Volume density of unilocular and multilocular adipose tissue 

Paraffin embedded perirenal fat sample sections were cut (5 μm), stained with hematoxylin and eosin (HE) and examined using an Olympus BX51 Light Microscope and ColorView II Camera (Soft Imaging Solutions, Münster, Germany). One section was randomly selected for each animal and systematic random sampling was used to select ten fields. Standard point counting techniques were used to determine the number of unilocular and multilocular cells in each tissue section as previously described [16], [17]. The volume density (Vd) of unilocular and multilocular adipose tissue was calculated using the formula: Vd = N/T, where N is the number of points falling on the unilocular or multilocular component, and T is the total number of points counted [17]. The mass of unilocular adipose tissue was determined by multiplying the total weight of the perirenal adipose tissue by the proportion of unilocular tissue.

2.7. Cross-sectional area and density of lipid locules 

The area of lipid locules in the unilocular component of the fetal adipose cell in each field of view was determined as previously described [16], [18]. Briefly, in each field of view, the perimeter of each of the lipid locules with a cross-sectional area >10 μm2 was manually traced and the AnalySIS software package (Soft Imaging Solutions, Münster, Germany) was used to determine the enclosed area. The total number of lipid locules in the 10 selected fields, and the area of each field were used to calculate the number of lipid locules/mm2 (i.e. the density of the lipid locules) in the PAT depots for the nineteen guinea pig fetuses.

2.8. Statistical analysis 

Data are presented as the mean ± SEM. The effect of age (i.e. 50 d gestation, 60 d gestation or pregnant females) on these parameters was determined using a one-way ANOVA. The analysis of the effect of age was only performed in Control fetuses and dams. Where the ANOVA identified a significant effect, the Duncan’s multiple range test was used post-hoc in order to determine significant differences between groups. Relationships between variables were determined using simple linear regression analysis. All statistical tests were carried out using SPSS for Windows version 16.0 (SPSS Inc., Chicago, IL). The effect of maternal undernutrition on fetal weight, placental weight, adipose tissue mass and the expression of adipocyte genes was determined by Student’s t-test. The effect of maternal undernutrition on the size distribution of lipid locules was analysed with a two-way ANOVA with repeated measures and Duncan’s post-hoc using STATA 10 (StataCorp LP, USA). The effect of maternal undernutrition on maternal weight gain both in absolute terms and as a percentage of weight in the preceding weeks was determined by a multifactorial ANOVA with repeated measures where sex, treatment and time were the independent variables using STATA 10 (StataCorp LP, USA).

A probability less than 5% (P < 0.05) was accepted as statistically significant.

Back to Article Outline

3. Results 

3.1. The effect of age on body weight, fat mass and expression of mRNA for lipogenic genes in the perirenal adipose tissue 

3.1.1. Body weight and fat mass 

Total body weight (Table 2) and placental weight were higher at 59–62 d gestation compared to 48–55 d gestation (placental weight, 48–55 d, 3.64 ± 0.18 g; 59–62 d, 4.99 ± 0.23; P < 0.05). Total PAT mass increased progressively from 50 d gestation into adult life (Table 2). The weight of PAT divided by total body weight (relative PAT mass) was higher at 59–62 d gestation compared to both the 48–55 d gestation and adult guinea pig (P < 0.05, Table 2).

Table 2. The effect of development on body weight, fat mass and expression of mRNA for lipogenic genes in the perirenal adipose tissue.
Control
Fetal lifeAdult life (n = 6)
48–55 d gestation (n = 4)59–62 d gestation (n = 8)
Body weight (g)37.2 ± 2.8a73.8 ± 2.3b1140.5 ± 29.2c
Total perirenal fat (g)0.24 ± 0.06a0.81 ± 0.12a6.39 ± 0.66b
Perirenal fat/body weight (g/g)0.006 ± 0.001a0.011 ± 0.001b0.005 ± 0.0004a
SCD-1 mRNA0.081 ± 0.0100.068 ± 0.007
FAS mRNA2.380 ± 0.299b0.847 ± 0.161a0.52 ± 0.24a
LPL mRNA5.801 ± 0.6134.861 ± 0.6614.02 ± 1.32
G3PDH mRNA1.377 ± 0.280b1.250 ± 0.150b0.015 ± 0.005a
Leptin mRNA12.51 ± 5.30

Data were analysed by one-way ANOVA and where the ANOVA revealed a significant effect, a Duncan’s post-hoc test was performed to determine significant differences between groups. Different letters denote values which are significantly different from each other as determined by one-way ANOVA and Duncan’s post-hoc.

3.1.2. Expression of lipogenic and adipogenic genes in perirenal adipose tissue 

The expression of FAS mRNA was highest at 48–55 d gestation, but was not different between the 59–62 d gestation and adult guinea pigs (Table 2). There was no difference in the expression of LPL mRNA between age groups (Table 2). SCD-1 expression was not detected in the adult guinea pig. SCD-1 mRNA was detected in fetal adipose tissue at both 48–55 d and 59–62 d gestation and was not different between these gestational ages (Table 2). Leptin mRNA expression was not detected in fetal PAT, but was expressed in adult PAT (Table 2). In contrast, G3PDH mRNA expression was higher in fetal compared to adult adipose tissue (Table 2).

3.2. The effect of maternal undernutrition on maternal and fetal body weight and fat mass 

3.2.1. Maternal and placental characteristics 

Maternal undernutrition resulted in a lower body weight in the UN dams compared to the Control dams throughout pregnancy (Fig. 1A) and UN dams were significantly lighter than Control dams at the time of post-mortem at 59–62 d gestation (Table 3). When weight gained in each week of pregnancy was expressed as a percentage of body weight at the start of that week, dams in the UN group had a higher rate of weight gain in week 1 of pregnancy and a lower rate of weight gain in week 2 of pregnancy when compared to Controls (Fig. 1B). The percentage weight gain during the remainder of pregnancy was not different between the Control and UN groups. There was no effect of maternal UN on litter size and either total or relative PAT mass in the dams (Table 3).

  • View full-size image.
  • Fig. 1 

    Maternal weight gain across pregnancy in absolute terms (A) and as a percentage of body weight in the preceding week of pregnancy (B) in Control (open circles) and undernutrition (closed circles) dams. Undernutrition dams were lighter than Control dams before and throughout pregnancy (P < 0.05) but exhibited a different pattern of weight gain during the first 2 weeks of pregnancy. Percent body weight gain from the previous week was calculated using the formula percent body weight gain in week b = ((body weight in week a − body weight in week b) body weight in week b) × 100. Multifactorial ANOVA with repeated measures where sex, treatment and time were the independent variables. * Denotes P < 0.05 compared with Control group.

Table 3. The effect of maternal undernutrition on maternal body weight, perirenal fat mass and mRNA expression of adipocyte genes in maternal adipose tissue.
Control (n = 6)Undernutrition (n = 7)
Body weight (g)1140.5 ± 29.2985.2 ± 43.2*
Litter size3.5 ± 0.23.0 ± 0.3
Total perirenal fat (g)6.39 ± 0.664.85 ± 0.51
Perirenal fat/body weight (g/g)0.005 ± 0.00040.004 ± 0.0004
FAS mRNA0.52 ± 0.240.59 ± 0.25
LPL mRNA4.02 ± 1.323.82 ± 0.97
G3PDH mRNA0.015 ± 0.0050.034 ± 0.013*
GLUT4 mRNA0.0089 ± 0.00420.017 ± 0.0067
Leptin mRNA12.51 ± 5.3012.17 ± 4.65

Asterisks (*) denote a significant difference between Control and UN pregnant dams (P < 0.05) determined by Student’s t-test. Expression of all genes was normalized to the housekeeper gene Acidic Ribosomal Protein P0 (RpP0).

There was a significant relationship between the absolute maternal weight gain throughout the whole of pregnancy and placental weight (Fig. 2A). When maternal weight gain in each week of pregnancy was separated, the maternal weight gain in pregnancy week 2 was the strongest predictor of placental weight in late gestation (Fig. 2A). Placental weight was lower in UN compared to Control fetuses at 59–62 d gestation (Fig. 2C).

  • View full-size image.
  • Fig. 2 

    The effect of maternal undernutrition on placental (A–C) and fetal weight (D) in Control (open circles) and UN (closed circles) guinea pigs. Maternal body weight gain across pregnancy (A) was related to mean placental weight (Fig. 2A; r2 = 0.32; P = 0.04; y = 0.005x + 3.0). Interestingly, maternal body weight gain in week 2 of pregnancy was exhibited the strongest relationship with placental weight in late gestation when weight gain in the individual weeks of pregnancy was assessed separately (Fig. 2B; r2 = 0.59; P = 0.002; y = 0.2x + 4.2). Maternal undernutrition resulted in lower placental (C) and fetal (D) weight compared to Controls.

3.2.2. Fetal characteristics 

Maternal undernutrition resulted in lower fetal body weight compared to the Control fetuses (Fig. 2D). There was no effect of maternal undernutrition on total or relative PAT mass in the fetuses (Table 4). There was, however, an effect of maternal undernutrition on the relationship between relative PAT mass and fetal growth. In the UN fetuses, relative PAT mass was inversely related to fetal weight (relative PAT = −0.0002 fetal weight + 0.0264; r2 = 0.81, P < 0.005, Fig. 3B) whereas in the Control group there tended (P = 0.05) to be a positive relationship between fetal weight and relative PAT mass (Fig. 3A).

Table 4. The effects of maternal undernutrition on the fetal perirenal fat mass and mRNA expression of adipocyte genes in fetal perirenal fat at 59–62 d gestation.
Control (n = 8)Undernutrition (n = 7)
Perirenal fat (g)0.78 ± 0.140.75 ± 0.02
Perirenal fat/body weight (g/g)0.011 ± 0.0010.012 ± 0.001
SCD-1 mRNA0.07 ± 0.010.08 ± 0.02
FAS mRNA0.85 ± 0.160.87 ± 0.19
LPL mRNA4.86 ± 0.665.22 ± 0.89
G3PDH mRNA1.34 ± 0.141.41 ± 0.34
GLUT4 mRNA0.97 ± 0.320.65 ± 0.24
  • View full-size image.
  • Fig. 3 

    The effect of maternal undernutrition on fetal weight and relative perirenal fat in Control (A) and UN (B) fetal guinea pigs. There was no significant relationship between fetal weight and relative perirenal fat mass in the Control fetuses (Fig. 1A, P = 0.053). In the UN group, however, there was a significant inverse relationship between fetal weight and relative perirenal fat mass (Fig. 2B, r2 = 0.81, P = 0.005, relative PAT = −0.0002 fetal weight + 0.0264).

3.3. The effects of maternal undernutrition on gene expression in the perirenal adipose tissue of pregnant dams and their pups 

3.3.1. Expression of lipogenic and adipogenic genes in maternal perirenal adipose tissue 

There was no difference in the relative expression of FAS, LPL or leptin mRNA in PAT between Control and UN dams (Table 3). There was a positive relationship between the expression of LPL mRNA and relative PAT mass (relative PAT = 0.0003 LPL mRNA + 0.0041; r2 = 0.48, P < 0.007) and between relative PAT mass and leptin mRNA expression (leptin mRNA = 7051 relative PAT mass − 24.44; r2 = 0.46, P < 0.01).

There was no effect of maternal UN on the expression of GLUT4 mRNA in PAT (Table 3). In UN dams, but not in Controls, there was a significant positive relationship between the expression of GLUT4 and FAS mRNA in PAT (FAS mRNA = 47.7 G3PDH mRNA − 1.07; r2 = 0.92, P < 0.002). The expression of GLUT1 mRNA in maternal PAT was below the limit of detection (data not shown).

3.3.2. Expression of adipogenic, lipogenic and glucose transporter genes in the fetal perirenal adipose tissue 

The expression of SCD-1, FAS and LPL mRNA in PAT was not different between Control and UN fetuses (Table 4). There was also no effect of maternal undernutrition on the expression of GLUT4 mRNA (Table 4). The expression of GLUT1 mRNA in fetal PAT was below the level of detection (data not shown).

3.3.3. Fetal perirenal adipose tissue morphometry 

Whilst the mean size of lipid locules in the fetal PAT was not higher in the UN fetuses (Control, 298 ± 25 μm2; UN, 359 ± 25 μm2, P = 0.07), there was a significant effect of UN on the size distribution of the lipid locules in PAT, such that there were more larger and less smaller locules present in this depot (group × locule size category, P < 0.002; Fig. 4). Specifically, the percentage of lipid locules in the UN fetal guinea pig was significantly lower in the <100 μm2 (P < 0.001), 100–200 μm2 (P = 0.04) but higher in the 300–400 μm2 (P = 0.004) categories. There was no effect of maternal UN on the number of lipid locules present in the field of view (Control, 151 ± 7; UN, 137 ± 6) or on the proportion of the PAT depot that was unilocular at 59–62 d gestation (Control, 65.5 ± 3.6%; UN, 72.6 ± 1.1%).

  • View full-size image.
  • Fig. 4 

    The percentage of lipid locules within different cell size categories between ad libitum fed and UN fetal guinea pigs at 59–62 d gestation. There was a significant effect of UN on the distribution of lipid locules across different size categories as determined by one-way ANOVA. Asterisks (*) denote a significant difference between the proportion of lipid locules within a particular size category in 59–62 d Control (open bars) and UN (closed bars) fetal guinea pigs (P < 0.05) as determined by a Duncan’s post-hoc.

Back to Article Outline

4. Discussion 

The present study reports the developmental profile of gene expression in the perirenal adipose tissue of the guinea pig and the effect of maternal undernutrition on the expression of genes involved in the regulation of lipogenesis within this fat depot in the dam and fetus. Exposure to maternal undernutrition resulted in the emergence of an inverse relationship between fetal body weight and the relative mass of the perirenal adipose depot, the main visceral fat depot in fetal life. Fetuses of undernourished mothers also had a higher proportion of large lipid locules in the perirenal adipose depot. This occurred in the absence of any alteration in the expression of genes known to be involved in promoting lipid storage and glucose uptake in postnatal life. These results support previous studies which have demonstrated that maternal undernutrition is associated with increases in the size of perirenal adipocytes in utero [11], and suggest that changes in perirenal adipose tissue morphometry occur in early life and precede changes in the expression of lipogenic genes.

4.1. The profile of adipose tissue deposition and adipocyte gene expression at different stages of development 

Our finding that the relative weight of the perirenal adipose depot increased between mid- and late gestation in the fetal guinea pig is consistent with the studies of Engle and colleagues [9], who reported an increase in total percentage body fat from 0.5% to 5.7% between 30 d gestation and term, i.e. a similar time frame to the present study. We also found that the weight of PAT as a proportion of body weight was higher in the late gestation fetal guinea pig than in the pregnant adult dam; this is likely to reflect the fact that the PAT is one of the only substantial fat depots in fetal life, but makes up only a relatively minor proportion of total body fat in the adult [9], [11].

The lipogenic enzymes FAS, LPL, G3PDH and SCD-1 were all expressed in the PAT of the guinea pig before birth. G3PDH mRNA was significantly higher in the fetal adipose tissue, which may suggest a greater reliance on de novo fatty acid synthesis from glucose in the relatively low glucose environment of the fetus when compared to the adult [19]. FAS mRNA expression was more than 3 fold higher in the mid-gestation fetus when compared to late gestation fetus and pregnant dam. This was unexpected given that fat deposition in the fetal guinea pig increases in late gestation [9], and that FAS plays a central role in the biosynthesis of long-chain fatty acids in adipose tissue of adults [13]. Previous studies have shown that there is an increased transfer of free fatty acids across the placenta into the fetal circulation with advancing gestation in the guinea pig [20], and this may act to reduce the requirement for FAS for de novo fatty acid synthesis. Unlike FAS, there was no effect of age on mRNA expression of LPL, an enzyme which facilitates the uptake of circulating non-esterified fatty acids into adipose cells [21]. The different profile of gene expression at different stages of fetal development is likely to reflect the gradual transition of this depot from predominately brown (thermogenic) adipose tissue in fetal life, to predominately white (storage) adipose tissue in adult life [22].

Interestingly, the expression of the lipogenic enzyme SCD-1 mRNA was below the limit of detection in the adult guinea pig, but was expressed in fetal PAT at both mid- and late gestation. SCD-1 forms an integral part of both the lipogenic and the lipid oxidative pathways and is present at high levels in the adipose tissue of adult rodents, sheep and humans [12]. The absence of detectable levels of SCD-1 mRNA in the adult PAT may suggest that the regulation of lipid synthesis in the adipose tissue of the adult guinea pig occurs through a lipogenic signalling pathway that is distinct from the SREBP-1c–SCD-1 mRNA signalling pathway which dominates in other species.

Our finding that leptin mRNA expression in PAT of the fetal guinea pig was below the limit of detection suggests that leptin mRNA expression may not reach appreciable levels until very close to term or after birth in the guinea pig. This finding was unexpected, since the guinea pig is a precocious species which develops significant fat deposits in fetal life, as in the human [9], [11], [23], [24]. We and others have previously reported that leptin is expressed in the fetal PAT of another precocious species, the sheep, from the time when the earliest fat deposits are formed in this species [25], [26]. A possible explanation for the lack of detectable leptin mRNA expression in the PAT of the guinea pig may be that leptin mRNA is expressed at higher levels in fat deposits other than those collected in this study. This is supported by existing studies which have shown higher levels of leptin mRNA expression in subcutaneous fat compared to visceral fat depots in humans, rats and sheep [15], [27], [28].

4.2. The effect of maternal undernutrition on fat deposition and expression of lipogenic enzymes in perirenal adipose tissue of the pregnant dam 

Exposure to undernutrition during pregnancy was associated with a lower body weight in the dam in late pregnancy. Consistent with previous studies in the guinea pig, maternal undernutrition during pregnancy resulted in reduced placental weight [29], [30]. Interestingly, we found that dams in the UN group exhibited a markedly slower rate of weight gain in the second week of pregnancy compared to Controls, and that the change in maternal weight in the first 2 weeks of pregnancy was correlated with placental weight in late gestation. In the human, low maternal weight gain during pregnancy is related to lower placental weight [31]. This relationship has not previously been shown in the guinea pig but it is known that the first 2 weeks of gestation are important for placental growth and development as the syncytiotrophoblast is well established and vascularised by day 18 [32].

There was no difference in the relative mass of PAT between Control and UN dams in late pregnancy. This is different from the results of previous studies in experimental animal models of undernutrition in rats and sheep, which have reported that maternal fat mass is lower in undernourished compared to control mothers in late pregnancy [33], [34], [35]. One possible explanation for this difference in results may be that fat stores were mobilised from depots other than the perirenal depot, but which were not collected in this study. In line with our finding that maternal undernutrition did not alter perirenal fat deposition in the pregnant dam, we also found no effect of maternal undernutrition on the relative expression of FAS, LPL, leptin or the insulin-dependent glucose transporter, GLUT4, in this adipose depot. The fact that G3PDH mRNA was upregulated in perirenal adipose tissue may suggest a compensatory increase in de novo lipid synthesis in visceral adipose tissue in an attempt to maintain maternal fat stores, however, this is difficult to determine in the absence of a measure of total body fat mass in these animals.

4.3. Effect of maternal undernutrition on the fetal guinea pig 

Our finding of a decrease in fetal body weight in late gestation in fetuses of UN dams is in line with previous studies in the guinea pig [11] and human [36]. Whilst we found no effect of maternal undernutrition on the relative mass of fetal PAT, exposure to maternal undernutrition was associated with the emergence of an inverse relationship between fetal weight and relative PAT mass, which would imply that, in the presence of reduced substrate supply, fat mass was increased in proportion with the degree of fetal growth restriction. This would align with the thrifty phenotype hypothesis, in which exposure to a suboptimal nutrient supply before birth leads the fetus to make adaptations, including an increased efficiency at storing fat in the visceral compartment, which favour survival in an environment of poor nutrition [7].

Exposure to maternal undernutrition was also associated with an increase in the proportion of large lipid locules in their perirenal adipose depot, and a trend towards an increase in lipid locule size. This is in agreement with the results of Kind and colleagues, who reported that maternal undernutrition in the guinea pig increased mean lipid locule size in the fetal perirenal adipose tissue, in the absence of any increase in relative perirenal fat mass [11]. We found no effect of maternal undernutrition on the number of lipid locules within the depot, or the proportion of the tissue that was made up of unilocular adipose tissue (a marker of the proportion of the tissues dedicated to lipid storage) [16], suggesting that the shift towards a greater population of larger lipid locules occurred in the absence of an increase in fat cell number.

Despite the significant shift in the size distribution of the lipid locules, and evidence of a disproportionate increase in perirenal fat deposition with decreasing fetal weight in fetuses exposed to maternal undernutrition, there was no effect of maternal undernutrition on the mRNA expression of the lipogenic enzymes SCD-1, FAS, LPL or G3PDH in fetal PAT. Previous studies in rats have found adipocytes from low-protein offspring had higher basal, but not insulin-stimulated, rates of glucose uptake compared to controls [37]. The expression of the insulin independent glucose transporter, GLUT1, however, was below the limit of detection in our current study. There was no effect of maternal undernutrition on GLUT4 mRNA expression in fetal perirenal fat suggesting that changes in basal or insulin-stimulated glucose uptake into visceral adipose tissue are unlikely to have made a substantial contribution to increases in lipid accumulation in fetuses of undernourished dams.

Back to Article Outline

5. Summary 

This study confirms previous work showing that maternal undernutrition results in increased fat storage in the fetal period, and provides information about the normal developmental profile and response to a reduction in nutrient supply of the key genes which regulate lipogenesis and glucose transport in the guinea pig. It is interesting that in a species with a high percentage of body fat at birth, and therefore more similar to the human in this sense than rodents and sheep, we found that there were key lipogenic genes which were not expressed in fetal and maternal adipose tissue. It would also appear that the increase in lipid storage in fetal fat depots in response to maternal undernutrition occurs in the absence of any increased in the expression of key lipogenic genes in this depot [10]. These data highlight the need for further investigations in order to define our understanding of the mechanistic pathway through which exposure to prenatal undernutrition results in increased adiposity and lipid locule size.

Back to Article Outline

Acknowledgements 

The authors thank Poh Seng Soo, Melissa Walker, Jayne Skinner, Heather Forbes and William Wang for their assistance with tissue collection. JLM is supported by a Career Development Award from the National Heart Foundation of Australia and the National Health and Medical Research Council of Australia (NHMRC). BM is supported by a Peter Doherty Postdoctoral Fellowship from the NHMRC.

Back to Article Outline

References 

  1. McMillen IC, Adam CL, Muhlhausler BS. Early origins of obesity: programming the appetite regulatory system. J Physiol (Lond). 2005;565(1):9–17
  2. Pietilainen KH, Kaprio J, Rasanen M, Winter T, Rissanen A, Rose RJ. Tracking of body size from birth to late adolescence: contributions of birth length, birth weight, duration of gestation, parents’ body size, and twinship. Am J Epidemiol. 2001;154(1):21–29
  3. Parsons TJ, Power C, Logan S, Summerbell CD. Childhood predictors of adult obesity: a systematic review. Int J Obes Relat Metab Disord. 1999;23(Suppl. 8):S1–S107
  4. Yajnik CS, Lubree HG, Rege SS, Naik SS, Deshpande JA, Deshpande SS, et al. Adiposity and hyperinsulinemia in Indians are present at birth. J Clin Endocrinol Metab. 2002;87(12):5575–5580
  5. Fall CHD, Osmond C, Barker DJP, Clark PMS, Hales CN, Stirling Y, et al. Fetal and infant growth and cardiovascular risk factors in women. Br Med J. 1995;310:428–432
  6. Malina RM, Katzmarzyk PT, Beunen G. Birth weight and its relationship to size attained and relative fat distribution at 7 to 12 years of age. Obes Res. 1996;4:385–390
  7. Hales CN, Barker DJP. The thrifty phenotype hypothesis. Br Med Bull. 2001;60(1):5–20
  8. Hediger ML, Overpeck MD, Kuczmarski RJ, McGlynn A, Maurer KR, Davis WW. Muscularity and fatness of infants and young children born small- or large-for-gestational-age. Pediatrics. 1998;102(5):1–7
  9. Engle WA, Lemons JA. Composition of the fetal and maternal guinea pig throughout gestation. Pediatr Res. 1986;20(11):1156–1160
  10. Kind KL, Clifton PM, Grant PA, Owens PC, Sohlstrom A, Roberts CT, et al. Effect of maternal feed restriction during pregnancy on glucose tolerance in the adult guinea pig. Am J Physiol Regul Integr Comp Physiol. 2003;284(1):R140–R152
  11. Kind KL, Roberts CT, Sohlstrom AI, Katsman A, Clifton PM, Robinson JS, et al. Chronic maternal feed restriction impairs growth but increases adiposity of the fetal guinea pig. Am J Physiol Regul Integr Comp Physiol. 2005;288(1):R119–R126
  12. Sampath H, Ntambi JM. Stearoyl-coenzyme A desaturase 1, sterol regulatory element binding protein-1c and peroxisome proliferator-activated receptor-alpha: independent and interactive roles in the regulation of lipid metabolism. Curr Opin Clin Nutr Metab Care. 2006;9(2):84–88
  13. Kersten S. Mechanisms of nutritional and hormonal regulation of lipogenesis. EMBO Rep. 2001;21(4):282–286
  14. Duffield JA, Vuocolo T, Tellam R, Yuen BS, Muhlhausler BS, McMillen IC. Placental restriction of fetal growth decreases IGF1 and leptin mRNA expression in the perirenal adipose tissue of late gestation fetal sheep. Am J Physiol Regul Integr Comp Physiol. 2008;294(5):R1413–R1419
  15. Muhlhausler BS, Duffield JA, McMillen IC. Increased maternal nutrition stimulates peroxisome proliferator activated receptor-{gamma} (PPAR{gamma}), adiponectin and leptin mRNA expression in adipose tissue before birth. Endocrinology. 2007;148:878–885
  16. Muhlhausler BS, Roberts CT, Yuen BSJ, Marrocco E, Budge H, Symonds ME, et al. Determinants of fetal leptin synthesis, fat mass, and circulating leptin concentrations in well-nourished ewes in late pregnancy. Endocrinology. 2003;144(11):4947–4954
  17. Muhlhausler BS, Roberts CT, McFarlane JR, Kauter KG, McMillen IC. Fetal leptin is a signal of fat mass independent of maternal nutrition in ewes fed at or above maintenance energy requirements. Biol Reprod. 2002;67(2):493–499
  18. Yuen BSJ, Owens PC, Muhlhausler BS, Roberts CT, Symonds ME, Keisler DH, et al. Leptin alters the structural and functional characteristics of adipose tissue before birth. FASEB J. 2003;17(9):1102–1104
  19. Block SM, Johnson RL, Sparks JW, Battaglia FC. Uterine metabolism of the pregnant guinea pig as a function of gestational age. Pediatr Res. 1988;23(1):45–49
  20. Thomas CR, Lowy C. Placental transfer of free fatty acids: factors affecting transfer across the guinea-pig placenta. J Dev Physiol. 1983;5(5):323–332
  21. Ullrich NF, Purnell JQ, Brunzell JD. Adipose tissue fatty acid composition in humans with lipoprotein lipase deficiency. J Investig Med. 2001;49(3):273–275
  22. Holloway BR, Davidson RG, Freeman S, Wheeler H, Stribling D. Post-natal development of interscapular (brown) adipose tissue in the guinea pig: effect of environmental temperature. Int J Obes. 1984;8(4):295–303
  23. Fowden A. Nutrient requirements for normal fetal growth and metabolism. In:  Hanson M,  Spencer J,  Rodeck C editor. Cambridge: Cambridge University Press; 1995;p. 31–56
  24. Merklin RJ. Growth and distribution of human fetal brown fat. Anat Res. 1973;178:637–646
  25. Yuen BSJ, McMillen IC, Symonds ME, Owens PC. Abundance of leptin mRNA in fetal adipose tissue is related to fetal body weight. J Endocrinol. 1999;163(3):R11–R14
  26. Ehrhardt RA, Bell AW, Boisclair YR. Spatial and developmental regulation of leptin in fetal sheep. Am J Physiol Regul Integr Comp Physiol. 2002;282(6):R1628–R1635
  27. Montague C, Prins J, Sanders L, Zhang J, Sewter C, Digby J, et al. Depot-related gene expression in human subcutaneous and omental adipocytes. Diabetes. 1998;47(9):1384–1391
  28. Oliver P, Pico C, Palou A. Ontogenesis of leptin expression in different adipose tissue depots in the rat. Eur J Physiol. 2001;442:383–390
  29. Sohlström A, Fernberg P, Owens JA, Owens PC. Maternal nutrition affects the ability of treatment with IGF-I and IGF-II to increase growth of the placenta and fetus, in guinea pigs. Growth Horm IGF Res. 2001;11(6):
  30. Sohlstrom A, Katsman A, Kind KL, Roberts CT, Owens PC, Robinson JS, et al. Food restriction alters pregnancy-associated changes in IGF and IGFBP in the guinea pig. Am J Physiol Endocrinol Metab. 1998;274(3):E410–E416
  31. Baptiste-Roberts K, Salafia C, Nicholson W, Duggan A, Wang N-Y, Brancati F. Maternal risk factors for abnormal placental growth: the national collaborative perinatal project. BMC Pregnancy Childbirth. 2008;8(1):44
  32. Tam WH, Burgess SM. The developmental changes in the placenta of the guinea-pig. J Anat. 1977;123(3):601–614
  33. Luther J, Aitken R, Milne J, Matsuzaki M, Reynolds L, Redmer D, et al. Maternal and fetal growth, body composition, endocrinology, and metabolic status in undernourished adolescent sheep. Biol Reprod. 2007;77(2):343–350
  34. Jelks A, Belkacemi L, Guang H, Chong W-L, Ross MG, Desai M. Paradoxical increase in maternal plasma leptin levels in food-restricted gestation: contribution by placental and adipose tissue. Reprod Sci. 2009;16(7):665–675
  35. Cripps RL, Green LR, Thompson J, Martin-Gronert MS, Monk M, Sheldon IM, et al. The effect of maternal body condition score before and during pregnancy on the glucose tolerance of adult sheep offspring. Reprod Sci. 2008;15(5):448–456
  36. Robinson JS, Falconer J, Owens JA. Intrauterine growth retardation: clinical and experimental. Acta Paediatr Scand. 1985;319(Suppl.):135–142
  37. Ozanne SE, Dorling MW, Wang CL, Nave BT. Impaired PI 3-kinase activation in adipocytes from early growth-restricted male rats. Am J Physiol Endocrinol Metab. 2001;280(3):E534–E539
  38. Aprikian O, Reynaud D, Pace-Asciak C, Leone P, Blancher F, Monnard I, et al. Neonatal dietary supplementation of arachidonic acid increases prostaglandin levels in adipose tissue but does not promote fat mass development in guinea pigs. Am J Physiol Regul Integr Comp Physiol. 2007;293(5):R2006–R2012

PII: S0143-4004(10)00283-3

doi:10.1016/j.placenta.2010.07.014

Placenta
Volume 31, Issue 10 , Pages 902-909, October 2010