Placenta
Volume 31, Issue 10 , Pages 937-940, October 2010

Reduced allele specific annexin A5 mRNA levels in placentas carrying the M2/ANXA5 allele

  • A. Markoff

      Affiliations

    • Institut für Medizinische Biochemie, ZMBE, WWU Münster, Von Esmarch Str. 56, 48149 Münster, Germany
    • Corresponding Author InformationCorresponding author. Tel.: +492518352126; fax: +492518356748.
    • ,
  • S. Gerdes

      Affiliations

    • Institut für Medizinische Biochemie, ZMBE, WWU Münster, Von Esmarch Str. 56, 48149 Münster, Germany
    • ,
  • S. Feldner

      Affiliations

    • Institut für Humangenetik, WWU and UKM Münster, Germany
    • ,
  • N. Bogdanova

      Affiliations

    • Institut für Humangenetik, WWU and UKM Münster, Germany
    • ,
  • V. Gerke

      Affiliations

    • Institut für Medizinische Biochemie, ZMBE, WWU Münster, Von Esmarch Str. 56, 48149 Münster, Germany
    • ,
  • E. Grandone

      Affiliations

    • Atherosclerosis and Thrombosis Unit, I.R.C.C.S. “Casa Sollievo della Sofferenza”, Poliambulatorio Giovanni Paolo II, S. Giovanni Rotondo (FG), Italy

Accepted 7 August 2010. published online 01 September 2010.

Article Outline

Abstract 

We aimed to trace the allele specific expression of ANXA5 mRNA in placentas carrying the M2 haplotype, conferring higher recurrent pregnancy loss risk, in order to verify directly the role of M2 in the relevant organ. The M2 allele in heterozygous placentas results in an average of 42% reduced ANXA5 mRNA levels as compared to the normal allele. Protein levels in these samples show considerable variations, impossible for statistical interpretation. The M2 allele of ANXA5 can be linked to reduced mRNA levels in heterozygous placentas and could result in more confined protein levels (lowered expression dynamics) of annexin A5.

Keywords: Annexin A5, ANXA5, M2 haplotype, Placenta, Pregnancy

 

Back to Article Outline

1. Introduction 

Annexin A5 shares the essential annexin family properties, but is a member that can be found extracellularly [1]. It can inhibit coagulation by various mechanisms [2], [3]. The regulation of ANXA5 gene expression in specific tissues is largely unknown. Annexin A5 is distributed abundantly and ubiquitously, mostly in kidney, liver and placenta [4]. The human ANXA5 gene generates several transcripts and has a complex promoter [5]. Annexin A5 is also known as placental anticoagulant protein. Lowered annexin A5 expression on placental trophoblast villi has been detected in the presence of antiphospholipid antibodies [6] and has also been confirmed immunohistochemically in patients with preeclampsia (PE) [7].

Recently, we observed that a sequence variation (M2 haplotype), reducing the activity of the ANXA5 gene promoter, represents a risk factor for recurrent pregnancy loss (RPL) [8]. The expression of ANXA5 mRNA in placentas from M2 haplotype carriers was decreased in comparison to normal controls, and in women with obstetric complications (PE and fetal growth restriction, FGR) it was lower than in a control group without pregnancy complications [9]. A more recent study on the role of M2 in RPL and other obstetric complications corroborated our initial findings and revealed an elevated pregnancy-related hypertensive disorder risk, together with a higher bearing on early fetal loss events [10].

In the present work we aimed to trace the source of reduced ANXA5 mRNA in placenta, reported previously for women carrying the M2/ANXA5 allele, using allele specific quantification analysis. We also studied the effect of reduced mRNA expression on estimated protein levels of annexin A5 in the same samples.

Back to Article Outline

2. Methods 

2.1. Genotyping 

Genomic DNA was extracted from maternal blood and lyophilized placenta, as described [11]. Samples were genotyped for M2/ANXA5 as indicated in [8]. Six samples from N/M2 heterozygous placentas and concordant or discordant maternal genotypes (2 cases and 1 control N/M2, 2 cases M2/M2 and 1 case N/N) and 16 N/N samples (13 cases and 3 controls) were analyzed from 18 PE and/or FGR cases and 4 controls.

2.2. DNA, RNA and protein extraction 

DNA, RNA and protein were extracted from 20 mg of the selected samples using the AllPrep DNA/RNA/Protein Mini Kit (Qiagen, Hilden, Germany).

2.3. Quantitative real time PCR (qRT PCR) 

Diluted reverse-transcribed cDNA were used for subsequent qRT PCR, with the Light Cycler 480 SYBR Green I Master Mix (Roche Applied Sciences, Mannheim, Germany) and gene specific primers. Amplifications were performed and quantitatively evaluated on a Light Cycler 480 System (Roche Applied Sciences, Mannheim, Germany), employing recommended conditions. For all samples a control housekeeping gene, TBP [12], amplicon was generated [13]. The N allele of ANXA5 was amplified in all samples using primers 5′ CAGTCTAGGTGCAGCTGCCG3′ and 5′GGTGAAGCAGGACCAGACTGT3′ and annealing at 65 °C, and the M2 allele was amplified in N/M2 samples with 5′CAGTCTAGGTGCAGCTGCCA3′ and 5′GGTGAAGCAGGACCAGACTGT3′ and annealing at 63 °C. Allelic mRNA quantities were normalized to TBP mRNA and the expression of N alleles in heterozygous samples N/M2 was compared to N/N using the REST software (REST 2008 V2.0.7, Corbett Research, Sydney, Australia). The strong PCR efficiencies correlation of the N and M2 alleles allowed the use of the 2DDCt method [14] for normalized allelic mRNA quantitative comparisons in N/M2 samples. Two independent assays were performed in triplicates for each amplicon.

2.4. Western blot analysis and protein quantification 

Proteins were analyzed using standard Western blot protocols (ECLplus, GE Healthcare, Freiburg, Germany). Annexin A5 was visualized using sheep anti-annexin A5 antibodies [15].

Back to Article Outline

3. Results and discussion 

3.1. ANXA5 allelic mRNA quantification in placenta samples 

Specific ANXA5 mRNA amplification formats for the normal (N) and haplotype M2 (M2) alleles utilized primers with G/A variation of the last nucleotide, corresponding to the last substitution of the M2 haplotype, 76G→A [8], shared by all detected transcripts of ANXA5 (Fig. 1a). An oligonucleotide bridging exons 1 and 2 served as a reverse primer. Allele specific amplification of this format was verified at respective annealing temperatures by direct product visualization (Fig. 1b) and melting curve analysis (Fig. 1c).

  • View full-size image.
  • Fig. 1 

    a) Scheme of the N and M2 ANXA5 allelic differences on the DNA and mRNA level and amplification strategy from cDNA. utr Exon 1, non-translated Exon 1, tsp, transcription start point; *, nucleotide count start; 1., 2., 3., variant ANXA5 transcripts; forward primer G anneals to all N ANXA5 transcripts, forward primer A anneals to all M2 ANXA5 transcripts. b) N/M2 allele specific PCR does not generate product from N/N samples, as demonstrated by direct visualization on 1.5% agarose gel. Arrow points at the specific amplicon band of 131 bp in the N/M2 control lane, asterisks below the N/N lanes denote non-utilized primers. c) Melting curve analysis of N/M2 M2 allele specific products. Melting curves are homogenous at ca. 93 °C, indicative of a single amplicon. Base line non-specific products appear only in water samples at ca. 82 °C.

The average expression of N allele in N/M2 heterozygous placentas (Fig. 2a) is about 0.4 of the expression in normal homozygote placentas, with a max. value of 0.52 in the middle 50% of observations (p = 0.000, randomization test). This is indicative of no allelic compensation of the reduced M2 ANXA5 mRNA through N ANXA5 mRNA. Next, reduced expression of the M2 allele in heterozygous placentas was verified through comparison of the M2 to N expression (Fig. 2b) and it was 0.42 normal allele levels, with a max. value of 0.46 in the interquartile range. This corroborates previous results on the measured M2 promoter activity, which was 37–42% of the normal allele [8]. One sample, showing atypically low M2 expression of 0.01.N with N expression in the normal range was excluded from the statistical evaluation. M2 ANXA5 mRNA is reduced in all N/M2 samples, regardless of the source of the M2 allele (in one discordant genotype sample M2 is of maternal, in the other of paternal origin).

  • View full-size image.
  • Fig. 2 

    a) Expression ratio of ANXA5 N allele mRNA in heterozygous (N/M2) vs normal homozygous (N/N) placentas. Output was generated with the REST (2008) software. b) Expression ratio of ANXA5 M2 allele mRNA to N allele mRNA in heterozygous (N/M2) placentas. Output was generated with the 2DDCt method. c) Typical western blot of placental protein samples. Blots were cut in strips around the relative molecular mass for α-tubulin (55 kDa) and annexin A5 (36 kDa). Lanes in upper rows were probed with anti-α-tubulin antibodies to ensure equal protein loading and lower row lanes were probed with anti-annexin A5 antibodies. Placental genotypes are indicated above each lane.

3.2. ANXA5 protein levels in N/N and N/M2 placenta samples 

Normalized protein levels in 30 μg of extracted protein were evaluated in N/M2 samples and compared to the N/N samples, with loading control (alpha-tubulin) and annexin A5 detection (Fig. 2c). Protein quantification in both sample groups (N/N vs. N/M2 placentas) was impossible to interpret statistically because of large intragroup variations, at, or several orders above detection limit. In a recent work Sifakis et al. [16] demonstrate significant differences in mRNA expression between normal and FGR pregnancies, and no such differences in protein levels, but the authors did not genotype their samples for M2/ANXA5.

Since endogenous expression is not the only source of ANXA5 in placental samples, heterogeneiety of tissue sections is crucial to consider, when estimating protein levels. The importance of timing and topical expression in placental microenvironments remains largely unknown. The recorded two-fold reduced range of protein concentrations in FGR samples [16] might reflect disturbed expression, due to the lower responsiveness of the M2 promoter allele. Broader expression dynamics might be potentially needed in enhanced vs. more enhanced anti-coagulation microenvironments of placenta tissue during fetal development.

Back to Article Outline

References 

  1. Gerke V, Creutz CE, Moss SE. . Annexins: linking Ca2+ signaling to membrane dynamics. Nat Rev Mol Cell Biol. 2005;6:449–461
  2. Thiagarajan P, Tait JF. Binding of annexin V/placental anticoagulant protein I to platelets. Evidence for phosphatidylserine exposure in the procoagulant response of activated platelets. J Biol Chem. 1990;265:17420–17423
  3. Ravassa S, Bennaghmouch A, Kenis H, Lindhout T, Hackeng T, Narula J, et al. Annexin A5 down-regulates surface expression of tissue factor: a novel mechanism of regulating the membrane receptor repertoir. J Biol Chem. 2005;280:6028–6035
  4. Morgan RO, Bell DW, Testa JR, Fernandez MP. Genomic locations of ANX11 and ANX13 and the evolutionary genetics of human annexins. Genomics. 1998;48:100–110
  5. Carcedo MT, Iglesias JM, Bances P, Morgan RO, Fernandez MP. Functional analysis of the human annexin A5 gene promoter: a downstream DNA element and an upstream long terminal repeat regulate transcription. Biochem J. 2001;356:571–579
  6. Rand JH, Wu XX, Guller S, Gil J, Guha A, Scher J, et al. Reduction of annexin-V (placental anticoagulant protein-I) on placental villi of women with antiphospholipid antibodies and recurrent spontaneous abortion. Am J Obstet Gynecol. 1994;171:1566–1572
  7. Shu F, Sugimura M, Kanayama N, Kobayashi H, Kobayashi T, Terao T. Immunohistochemical study of annexin V expression in placentae of preeclampsia. Gynecol Obstet Invest. 2000;49:17–23
  8. Bogdanova N, Horst J, Chlystun M, Croucher PJ, Nebel A, Bohring A, et al. A common haplotype of the annexin A5 (ANXA5) gene promoter is associated with recurrent pregnancy loss. Hum Mol Genet. 2007;16:573–578
  9. Chinni E, Tiscia GL, Colaizzo D, Vergura P, Margaglione M, Grandone E. Annexin V expression in human placenta is influenced by the carriership of the common haplotype M2. Fertil Steril. 2009;91:940–942
  10. Tiscia G, Colaizzo D, Chinni E, Pisanelli D, Sciannamè N, Favuzzi G, et al. Haplotype M2 in the annexin A5 (ANXA5) gene and the occurrence of obstetric complications. Thromb Haemost. 2009;102:309–313
  11. Chinni E, Colaizzo D, Margaglione M, Rubini C, D’Ambrosio RL, Giuliani F, et al. Correlation between factors involved in the local haemostasis and angiogenesis in full term human placenta. Thromb Res. 2008;122:376–382
  12. Meller M, Vadachkoria S, Luthy DA, Williams MA. Evaluation of housekeeping genes in placental comparative expression studies. Placenta. 2005;26:601–607
  13. Bièche I, Onody P, Tozlu S, Driouch K, Vidaud M, Lidereau R. Prognostic value of ERBB family mRNA expression in breast carcinomas. Int J Cancer. 2003;106:758–765
  14. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25:402–408
  15. Markoff A, Bogdanova N, Knop M, Rüffer C, Kenis H, Lux P, et al. Annexin A5 interacts with polycystin-1 and interferes with the polycystin-1 stimulated recruitment of E-cadherin into adherens junctions. J Mol Biol. 2007;369:954–966
  16. Sifakis S, Soufla G, Koukoura O, Soulitzis N, Koutroulakis D, Maiz N, et al. Decreased annexin A5 mRNA placental expression in pregnancies complicated by fetal growth restriction. Thromb Res. 2010;125:326–331

PII: S0143-4004(10)00297-3

doi:10.1016/j.placenta.2010.08.002

Placenta
Volume 31, Issue 10 , Pages 937-940, October 2010

Article Tools

* Image Usage & Resolution