Placenta
Volume 31, Issue 11 , Pages 1003-1009, November 2010

Roles of TauT and system A in cytoprotection of rat syncytiotrophoblast cell line exposed to hypertonic stress

  • T. Nishimura

      Affiliations

    • Faculty of Pharmacy, Keio University, 1-5-30 Shibakoen, Minato-ku, Tokyo 105-8512, Japan
    • ,
  • Y. Sai

      Affiliations

    • Faculty of Pharmacy, Keio University, 1-5-30 Shibakoen, Minato-ku, Tokyo 105-8512, Japan
    • Department of Pharmacy, Kanazawa University Hospital, 13-1 Takara-machi, Kanazawa 920-8641, Japan
    • ,
  • J. Fujii

      Affiliations

    • Faculty of Pharmacy, Keio University, 1-5-30 Shibakoen, Minato-ku, Tokyo 105-8512, Japan
    • ,
  • M. Muta

      Affiliations

    • Faculty of Pharmacy, Keio University, 1-5-30 Shibakoen, Minato-ku, Tokyo 105-8512, Japan
    • Faculty of Medical Health, Teikyo Heisei University, 2-51-4 Higashi Ikebukuro, Toshima-ku, Tokyo 170-8445, Japan
    • ,
  • H. Iizasa

      Affiliations

    • Faculty of Pharmacy, Keio University, 1-5-30 Shibakoen, Minato-ku, Tokyo 105-8512, Japan
    • Institute for Genetic Medicine, Hokkaido University, Kita-15, Nishi-7, Kita-ku, Sapporo 060-0815, Japan
    • ,
  • M. Tomi

      Affiliations

    • Faculty of Pharmacy, Keio University, 1-5-30 Shibakoen, Minato-ku, Tokyo 105-8512, Japan
    • ,
  • M. Deureh

      Affiliations

    • Faculty of Pharmacy, Keio University, 1-5-30 Shibakoen, Minato-ku, Tokyo 105-8512, Japan
    • ,
  • N. Kose

      Affiliations

    • Faculty of Pharmacy, Keio University, 1-5-30 Shibakoen, Minato-ku, Tokyo 105-8512, Japan
    • ,
  • E. Nakashima

      Affiliations

    • Faculty of Pharmacy, Keio University, 1-5-30 Shibakoen, Minato-ku, Tokyo 105-8512, Japan
    • Corresponding Author InformationCorresponding author. Tel.: +81 3 5400 2660; fax: +81 3 5400 2553.

Accepted 9 August 2010. published online 01 September 2010.

Article Outline

Abstract 

The purpose of this study was to clarify the cytoprotective mechanism(s) induced in a conditionally immortalized syncytiotrophoblast cell line (TR-TBT 18d-1) exposed to hypertonic conditions. Hypertonicity-induced apoptosis of TR-TBT 18d-1 cells, but this was blocked by addition of 1 mM taurine to the culture medium. TauT-knockdown using siRNA revealed that TauT is a major contributor to taurine uptake by TR-TBT 18d-1 cells, at least under normal conditions. Cellular uptake of [3H]taurine and [14C]betaine by TR-TBT 18d-1 cells cultured under hypertonic conditions was increased compared to that under normal conditions. TauT, BGT-1, ATA2 and HSP70 mRNAs were upregulated by hypertonicity, while OCTN2, ENT1 and CNT1 mRNAs were downregulated. [3H]Taurine uptake was strongly inhibited by TauT inhibitors such as hypotaurine and β-alanine. MeAIB, a system A specific substrate, inhibited hypertonic stress-induced [14C]betaine uptake. These results suggest that TauT and system A play cytoprotective roles in syncytiotrophoblasts exposed to hypertonic stress.

Keywords: Syncytiotrophoblast, Taurine, Betaine, Hypertonicity, System A, TauT

Abbreviations: ATA2, amino acid transporter 2, BGT-1, betaine/GABA transporter, CNT2, concentrative nucleoside transporter 2, ENT1, equilibrative nucleoside transporter 1, G3PDH, glyceraldehyde-3-phosphate dehydrogenase, HSP70, heat-shock protein 70, MeAIB, 2-methylaminoisobutyric acid, OCTN2, organic cation/carnitine transporter, TauT, taurine transporter, TonEBP, tonicity-responsive enhancer binding protein

 

Back to Article Outline

1. Introduction 

Membrane transporters expressed in syncytiotrophoblasts of the placenta function for selective transport of nutrients and fetal wastes between maternal and fetal blood. The fetal plasma osmolality is about 10 mOsm/kg higher than the maternal plasma osmolality, and maternal and fetal plasma osmolality increases during the post-term period in rats [1]. Maternal plasma osmolality is also increased in gestational diabetes and renal disorder. Therefore, syncytiotrophoblasts may be exposed to osmotic stress.

Intracellular accumulation of organic osmolytes by active transport, as well as endogenous synthesis, enhances the tolerance of renal medullary cells and small intestinal epithelial cells to high osmotic pressure [2], [3], [4], [5], [6]. Although taurine and betaine taken up by active plasma membrane transport are abundant in rat and human placenta [7], it has not been clarified whether these osmolytes are involved in the cytoprotective mechanisms induced in syncytiotrophoblasts exposed to hypertonic conditions.

TauT mediates the uptake of taurine, β-alanine and GABA [8], [9], [10]. Betaine and GABA are substrates for betaine/GABA transporter (BGT-1) [11], [12]. Three subtypes of amino acid transport system A, namely amino acid transporters 1, 2 and 3 (ATA1, 2, 3), have been cloned from rat tissues [13], [14], [15]. ATA2 is expressed in the brush-border membrane of syncytiotrophoblasts in human [16]. ATA2 mediates the uptake of neutral amino acids and MeAIB, a specific substrate of system A. These osmolyte transporters are transcriptionally regulated by osmotic stress [17], [18], [19]. However, it is not known which osmolyte transporter is mainly upregulated in syncytiotrophoblasts.

Tonicity-responsive enhancer binding protein (TonEBP) is a transcriptional factor that regulates mRNA expression of osmolyte transporters and heat-shock protein 70 (HSP70). After activation by mitogen-activated protein kinase and Fyn tyrosine kinase, TonEBP binds to tonicity-response elements that are present in the control regions of osmotically regulated genes [20], [21], [22], [23], [24]. TonEBP-deficient mice exhibit embryonic lethality from the middle to later period of gestation [25]. Thus, TonEBP-mediated osmoprotective mechanisms in syncytiotrophoblasts may be important to maintain gestation.

A conditionally immortalized syncytiotrophoblast cell line (TR-TBT 18d-1) was established from the placenta of a rat at the gestational age of 18 days, and expresses at least TauT, BGT-1 and ATA2 mRNAs [26]. We have shown that TR-TBT 18d-1 cells have transport activities for nucleosides and nucleoside analogs, and exhibit hormonal regulation [27], [28], [29], [30]. Thus, TR-TBT 18d-1 cells appear to be a suitable model for functional transport analysis of syncytiotrophoblasts. The purpose of this study was to clarify the mechanism of the cytoprotective effect of taurine in syncytiotrophoblast cells exposed to hypertonic conditions and to identify the pivotal osmolyte transporter(s) that is upregulated under such conditions.

Back to Article Outline

2. Materials and methods 

2.1. Chemicals 

[1,2-3H]Taurine (1.18 TBq/mmol) was purchased from Amersham Biosciences (Buckinghamshire, UK) and [1-14C]betaine (2.035 GBq/mmol) from American Radiolabeled Chemicals, Inc. (St. Louis, MO, USA). All other reagents were commercial products of reagent grade.

2.2. Cell culture 

TR-TBT 18d-1 cells were handled as described previously [26]. Briefly, they were maintained in Dulbecco’s modified Eagle’s medium (DMEM) (Nissui Pharmaceutical Co., Ltd., Tokyo), supplemented with 10% fetal bovine serum (JRH Biosciences, Lenexa, KS, USA) and 2 mM L-glutamine (Gibco, Grand Island, NY, USA) at 33 °C in a humidified atmosphere of 5% CO2. For all osmotic stress tests and uptake studies, TR-TBT 18d-1 cells were cultured for 5 days in DMEM with osmolality appropriately controlled with sorbitol at 37 °C.

2.3. Evaluation of cytotoxicity due to hypertonicity 

TR-TBT 18d-1 cells were seeded at the density of 1 × 105 cells/well on 12-mm collagen-coated cover glasses (Iwaki, Tokyo, Japan) for DAPI staining or 5 × 106 cells/dish on 10-cm collagen-coated dishes (Iwaki) for DNA fragment assay and caspase-3 activity assay. The cells were cultured for 2 days at 33 °C and a further 3 days at 37 °C, then incubated at 500 mOsm/kg for 24 h and 700 mOsm/kg for a further 24 h (hypertonic condition) or at 300 mOsm/kg for 48 h (normal condition) at 37 °C. To address the cytoprotective effect of taurine, 1 mM taurine was supplemented in the hypertonic medium. The cells were mounted in VECTASHIELD mounting medium with DAPI (Vector Laboratories, Burlingame, CA, USA). DNA fragmentation was measured using a Quick Apoptotic DNA ladder detection kit (Biovision Inc., CA, USA). Caspase-3 activity was measured with a CaspACE assay system, fluorometric (Promega, Madison, WI, USA).

2.4. Construction of siRNA-TauT stably transfected TR-TBT 18d-1 cells 

The siRNA sequence of the sense strand for TauT was designed as 5′-GGAAGGGTTATCGTCGGGA-3′ (accession number NM_017206), which has no significant homology with other genes. The siRNA sequence and its complementary sequence were linked by an 8-bp hairpin loop and the construct was inserted into pSuppressorNeo (Imgenex, San Diego, CA, USA). TR-TBT 18d-1 cells were transfected with pSuppressorNeo/siRNA-TauT or the vector (mock) using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA). The transfected cells were screened in culture medium supplemented with 500 μg/mL G418 (Calbiochem, La Jolla, CA, USA). The contribution of TauT to taurine uptake in TR-TBT 18d-1 cells was estimated on the assumption that TauT mRNA level is linearly related to TauT membrane expression and function in the present study.

2.5. Osmolyte uptake and cell proliferation assay in TR-TBT 18d-1 cells 

TR-TBT 18d-1 cells were initially grown for 4 days in 300 mOsm/kg DMEM and then exposed for up to 24 h to 300 or 500 mOsm/kg DMEM. The culture medium was removed, and the cells were washed twice with the uptake buffer containing 122 mM NaCl, 25 mM HOCH2(CHOH)4COONa, 3 mM KCl, 1.4 mM CaCl2, 1.2 mM MgSO4, 0.4 mM K2HPO4, 10 mM d-glucose, 10 mM Hepes and 300 mM or 500 mM sorbitol adjusted at pH 7.4. After preincubation in the uptake buffer for 10 min, radiolabeled osmolyte uptake was initiated by adding 400 μL of the uptake buffer in the absence and presence of inhibitors. The uptake was terminated by removal of the medium by aspiration, followed by washing three times with ice-cold uptake buffer. Cells were then lysed with 500 μL of 0.1 N NaOH containing 1% Triton-X 100, and radioactivity was quantified with a liquid scintillation counter. Effect of osmolyte on cell proliferation was analyzed by non-radioactive cell proliferation assay (Promega), according to the manufacture’s instructions.

2.6. Real-time quantitative PCR of TauT 

Total RNA was extracted from TR-TBT 18d-1 cells stably transfected with siRNA-TauT or the vector (mock) using a QIAGEN RNeasy Mini Kit (QIAGEN, Valencia, CA). The first-strand of cDNA was synthesized as described above, and quantitative real-time PCR was performed with an ABI PRISM 7700 sequence detector system. PCR was conducted with TaKaRa SYBR Premix Ex Taq (TaKaRa) under the following conditions: preincubation at 95 °C for 10 s, followed by 40 cycles of 95 °C for 5 s, 59 °C for 20 s, and 72 °C for 30 s. The primer sequences used for TauT mRNA quantification were 5′-GAGGTCATCATAGGCCAGTACAC-3′ (sense strand) and 5′-TTGCGCTCCCAGAACTCGATCA-3′ (anti-sense strand).

2.7. Semi-quantitative RT-PCR analysis 

Expression levels of rat G3PDH, TauT, BGT-1, ATA1, HSP70, organic cation/carnitine transporter (OCTN2), concentrative nucleoside transporter 2 (CNT2), equilibrative nucleoside transporter 1 (ENT1) and G3PDH in TR-TBT 18d-1 cells were semi-quantitatively determined by RT-PCR analysis. The sequences of sense and anti-sense primers and the experimental conditions are summarized in Table 1.

Table 1. Semi quantitative RT-PCR condition and primer sequence for the rat genes.
GeneAccession No.Sense primerAnti-sense primerTemp (°C)aPCR cyclesProduct size (bp)
TauTM96601TTCCTACGCTATCTGCCTGGATACATGCCACCCTCCGTCA5725460
BGT-1U28927ACCAGGGCATCGTCTTCTACTGACCAGGCACTCCATACAG5735322
ATA2AF273024AAGGCATACGGTCTGGCTGGTATCGGCTGCGGTGCTGTTG5921414
HSP70L16764AAGCAGACGCAGACCTTCAGGTGATCTTGTTGGCCTTG6024240
OCTN2AF110416TGGGATTGTTGCGCCTTCCAGAAGAGGGCAGCAGAGATAG5827313
CNT2U66723AGCAACGGAGCCACAGATGCCAAGCCTCCCAGTGTGATCC5927419
ENT1AF015304CAACTACACAGCCCCCATCAGCAGTCACAGCAGGGAACAA5722425
G3PDHAF10680ACCACAGTCCATGCCATCACTCCACCACCCTGTTGCTGTA5717451

aAnnealing temperature.

TR-TBT 18d-1 cells seeded on collagen-coated dishes (Iwaki) were initially grown for 4 days in 300 mOsm/kg DMEM and then further cultured for 8 h in 300 or 500 mOsm/kg DMEM. Total RNA was isolated by the acid phenol procedure using ISOGEN (Wako Pure Chemical Industries Ltd., Osaka, Japan). cDNA was synthesized from 1 mg of total RNA using oligo (dT)15 as a primer and M-MLV reverse transcriptase (Rever Tra Ace; Toyobo, Osaka, Japan). RT-PCR was performed with TAKARA Ex Taq (Takara, Tokyo, Japan). The reaction was carried out for 17–35 cycles, using the following cycle sequence: 94 °C 1 min for denaturing, 57–60 °C 1 min for annealing, and 72 °C 1 min for extension. The PCR products were visualized by ethidium bromide staining after 5% acrylamide gel electrophoresis and the band density was analyzed with Quantity One software (Bio-Rad, Hercules, CA, USA).

2.8. Data analysis 

Results were expressed as the mean ± S.E.M. (standard error of mean), and statistical analyses were performed by the use of Student’s t-test or one-way analysis of variance (ANOVA) with Dunnett’s post hoc test for multiple comparison.

Back to Article Outline

3. Results 

3.1. Cytotoxicity of hypertonic medium to TR-TBT 18d-1 cells 

To investigate the effect of osmolytes on cytotoxicity induced by exposure of TR-TBT 18d-1 cells to hypertonic conditions, we first established appropriate cell culture conditions to manifest cytotoxicity. Culture in hypertonic medium caused significant fragmentation of cellular DNA in TR-TBT 18d-1 cells, as compared with cells cultured in isotonic medium (Fig. 1A). Nuclear staining with DAPI confirmed the DNA fragmentation (Fig. 1B). These results indicate that apoptosis of TR-TBT 18d-1 cells was induced under hypertonic conditions. To address the cytoprotective effect of an osmolyte, 1 mM taurine was added to the hypertonic culture medium. As a parameter to measure hypertonicity-induced apoptosis quantitatively, we employed caspase-3 activity. While caspase-3 activity was quite high in TR-TBT 18d-1 cells cultured in the hypertonic condition, the activity was significantly reduced by the addition of 1 mM taurine (Fig. 1C). Bright-field images confirmed the cytoprotective effect of taurine (Fig. 1D). No further cytoprotective effect was observed when the concentration of taurine was further increased (data not shown).

  • View full-size image.
  • Fig. 1 

    Hypertonicity-induced cytotoxicity and cytoprotective effect of taurine in TR-TBT 18d-1 cells. Electrophoresis of DNA extracted from TR-TBT 18d-1 cells cultured in the normal (lane 2) or hypertonic medium (lane 3), revealing a hypertonicity-induced apoptotic ladder (A). Lane 1 is molecular weight markers. Nuclei of TR-TBT 18d-1 cells cultured in the normal (B, left) or hypertonic medium (B, right) were stained with DAPI. The cytoprotective effect of taurine on hypertonicity-induced cytotoxicity was evaluated by measuring caspase-3 activity (C). Each column shows the mean ± S.E.M. (n = 3–4). A statistically significant difference is indicated by an asterisk * (p < 0.05). Hypertonicity-induced cytotoxicity and the cytoprotective effect of taurine were visualized by bright-field imaging (D).

3.2. Contribution of TauT to endogenous taurine uptake 

To clarify the involvement of TauT in taurine uptake by TR-TBT 18d-1 cells, a TauT-knockdown cell line was constructed by stable transfection with siRNA-TauT. mRNA expression of TauT was 58.7% lower in siRNA-TauT-transfected TR-TBT 18d-1 cells than in mock cells (Fig. 2A). [3H]Taurine uptake was almost completely saturable in siRNA-TauT-transfected TR-TBT 18d-1 cells and mock cells, and siRNA-TauT blocked 46.5% of the saturable uptake (Fig. 2B). The contribution of TauT to endogenous taurine uptake in TR-TBT 18d-1 cells was estimated to be 79.3% of total uptake, assuming that TauT mRNA expression is linearly related to taurine uptake.

  • View full-size image.
  • Fig. 2 

    Contribution of TauT to taurine uptake by TR-TBT 18d-1 cells. Uptake of [3H]taurine by TR-TBT 18d-1 cells stably transfected with vector (mock) and with siRNA-TauT was measured for 5 min at 37 °C (A). The uptake is presented as cell-to-medium ratio. Saturable uptake was evaluated by the addition of an excess concentration (2 mM) of unlabeled taurine. mRNA expression of TauT in TR-TBT 18d-1 cells stably transfected with vector (mock) and siRNA-TauT was measured by real-time PCR (B). Each column shows the mean ± S.E.M. (n = 3–4). A statistically significant difference is indicated by an asterisk * (p < 0.05).

3.3. Hypertonicity-induced osmolyte uptake in TR-TBT 18d-1 cells 

To address the uptake activity of osmolytes in TR-TBT 18d-1 cells cultured in hypertonic medium, radiolabeled taurine uptake and betaine uptake were measured. Both [3H]taurine and [14C]betaine uptakes were significantly increased in TR-TBT 18d-1 cells exposed to hypertonic medium, as compared with normal medium (Fig. 3A and B), indicating that a transporter(s) responsible for osmolyte uptake was induced under the hypertonic condition.

  • View full-size image.
  • Fig. 3 

    Effect of osmotic stress on [3H]taurine and [14C]betaine uptake and the expression levels of osmosensitive genes in TR-TBT 18d-1 cells. Hypertonicity-induced [3H]taurine (10 nM, A) and [14C]betaine (3 μM, B) uptake by TR-TBT 18d-1 cells cultured in normal (○) and hypertonic (●) medium was measured at 37 °C. The uptake is presented as cell-to-medium ratio. Each point represents the mean ± S.E.M. (n = 3–4). mRNA expression of putative osmolality-sensitive genes was measured by semi-quantitative RT-PCR (C). Each column represents the mean ± S.E.M. (n = 3). A statistically significant difference is indicated by an asterisk * (p < 0.05).

3.4. mRNA expression of hypertonicity-induced osmolyte transporters in TR-TBT 18d-1 

The mRNA expression levels of osmolyte transporters and osmotic stress-related proteins in TR-TBT 18d-1 cells exposed to 500 mOsm/kg for 8 h were analyzed by means of semi-quantitative RT-PCR. TauT, BGT-1 ATA2 and HSP70 mRNA levels were 2–6-fold higher in TR-TBT 18d-1 cells cultured in hypertonic medium compared to that in normal medium, while OCTN2, CNT2 and ENT1 mRNA levels were 2–4-fold lower (Fig. 3C). G3PDH mRNA expression levels were similar in both conditions (Fig. 3C).

3.5. Contributions of TauT, BGT-1 and system A to stress-induced taurine and betaine uptake 

To identify transporters functionally involved in the stress-induced taurine and betaine uptake, the effects of inhibitors of osmolyte transporters were examined. Taurine, hypotaurine, β-alanine and GABA (1 mM) inhibited endogenous and hypertonicity-induced taurine uptake, while MeAIB slightly inhibited hypertonicity-induced taurine uptake (Fig. 4A). Betaine and MeAIB significantly inhibited endogenous and hypertonicity-induced betaine uptake, but GABA had no effect (Fig. 4B).

  • View full-size image.
  • Fig. 4 

    Inhibition study of [3H]taurine and [14C]betaine uptake by TR-TBT 18d-1 cells cultured in normal and hypertonic media. TR-TBT 18d-1 cells were cultured for 8 h in 300 mOsm/kg and 500 mOsm/kg medium. Cells were incubated with 10 nM [3H]taurine (A) or 3 μM [14C]betaine (B) in the absence and presence of inhibitors. Data are presented as the mean ± S.E.M. (n = 3–4). A statistically significant difference is indicated by an asterisk * (p < 0.05).

3.6. Effect of taurine and betaine transport systems on cytoprotection against hypertonicity in TR-TBT 18d-1 cells 

To clarify the role of taurine and betaine transport systems in hypertonicity, TR-TBT 18d-1 cell proliferation was assayed in the presence of taurine, betaine and inhibitors of the respective transport systems, inhibitor, hypotaurine and MeAIB. Hypertonicity reduced the proliferation rate compared to an isotonic condition. Betaine, hypotaurine and MeAIB, as well as taurine, partly restored the proliferation (Fig. 5).

  • View full-size image.
  • Fig. 5 

    Effect of osmolytes on proliferation of TR-TBT 18d-1 cells. TR-TBT 18d-1 cells were cultured for 48 h in 300 mOsm/kg (normal condition) and 500 mOsm/kg medium (hypertonic condition). Cells were cultured in the absence (control) and presence of 1 mM osmolyte. Data are presented as the mean ± S.E.M. (n = 4). A statistically significant difference from the control is indicated by an asterisk * (p < 0.05).

Back to Article Outline

4. Discussion 

Many types of cells have mechanisms for responding to osmotic stress. Taurine, betaine and myo-inositol are involved in cell volume homeostasis, as well as in cell protection. The intracellular osmolality is generally adjusted by accumulation of inorganic electrolytes. However, since cells can not tolerate high intracellular concentrations of inorganic electrolytes, transporters for organic osmolytes, which have little cytotoxicity, are expected to be induced by severe hypertonic stress to accumulate organic osmolytes. Here, we examined the cytoprotective mechanisms induced in TR-TBT 18d-1 cells exposed to hypertonic conditions.

Severe hypertonicity (500–700 mOsm/kg) induced apoptosis in TR-TBT 18d-1 cells (Fig. 1A and B). In this condition, it is unlikely that aldose reductase contributes to cytoprotection. The cytotoxicity was significantly reduced by the addition of 1 mM taurine (Fig. 1C and D), suggesting that extracellular taurine works as an osmolyte and contributes to resistance to hypertonicity-induced apoptosis. Since maternal plasma contains 30–60 μM taurine [31] and the affinity of TauT for taurine transport is approximately 40 μM [8], plasma taurine can be taken up by syncytiotrophoblasts and work as an organic osmolyte in the placenta.

It has been reported that taurine uptake across the brush-border membrane of syncytiotrophoblasts is mediated by a sodium-dependent taurine transporter [32], and the subcellular localization of TauT is primarily in the brush-border membrane of human syncytiotrophoblasts [33]. We have here provided direct evidence that TauT is the predominant contributor to taurine uptake in TR-TBT 18d-1 cells by means of knockdown with siRNA (Fig. 2).

Hypertonicity-induced uptake of taurine and expression of TauT mRNA in TR-TBT 18d-1 cells (Fig. 3). Endogenous and hypertonicity-induced [3H]taurine uptake was almost completely inhibited by excess concentration of unlabeled taurine, hypotaurine and β-alanine (Fig. 4), indicating that TauT had a predominant role in the both uptake. These results are consistent with the report of upregulation of TauT in other tissue and cells, including other blood-tissue barrier cell lines [34], [35], [36], [37]. In addition to TauT induction, hypertonicity-induced uptake of betaine and mRNA expression of BGT-1 and ATA2 (Fig. 3). Thus, other osmolytes, as well as taurine, may afford cytoprotection from hypertonicity. Induction of BGT-1 and system A in syncytiotrophoblasts is consistent with that in endothelial cells [19], [38]. In addition, hypertonicity-induced betaine uptake was almost completely inhibited by MeAIB, but not by GABA, although mRNA of BGT-1 was induced (Figs. 3C and 4). These results suggest that system A as well as TauT has a cytoprotective physiological function, at least in syncytiotrophoblasts. Although the direct evidence that rat ATA2 transports betaine has not been reported, these results are similar to the inhibitory effect of MeAIB on hypertonicity-induced betaine uptake by rat hepatic stellate cells [39]. SIT1 is a known betaine transporter which can be inhibited by MeAIB, but it is unlikely that SIT1 is involved in betaine uptake in TR-TBT 18d-1 cells since SIT1 mRNA is not expressed at all in rat placenta [40]. To examine whether ATA2 can transport betaine, we performed an uptake study with ATA2 cRNA-injected and non-injected Xenopus oocytes. In addition to significant uptake of [3H]MeAIB (456 ± 5 and 325 ± 25 nL/60 min/oocyte in ATA2 cRNA-injected and non-injected Xenopus oocytes, respectively; p < 0.05), [14C]betaine was also significantly taken up (101 ± 19 and 34 ± 1 nL/60 min/oocyte in ATA2 cRNA-injected and non-injected Xenopus oocytes, respectively; p < 0.05), indicating that [14C]betaine is an uptake substrate of ATA2. Similar cytoprotection by taurine and betaine was experimentally observed in proliferation assay (Fig. 5). The physiological taurine concentration in plasma (see above) is slightly lower than that of betaine (approximately 100–200 μM) [41], [42], but the uptake clearance of taurine is 10-fold higher than that of betaine (Fig. 3A and B), indicating that taurine makes a greater contribution than betaine to the cytoprotective effect. On the other hand, mRNA expression levels of OCTN2, CNT2 and ENT1 were decreased (Fig. 3C), suggesting that substrates of these transporters, such as carnitine and nucleosides, may not contribute to cytoprotection from hypertonicity, at least as judged from their influx transport activity.

It is known that TonEBP is involved in the transcription of various proteins, including osmolyte transporters. Human and ovine placental expression of TonEBP was recently reported [43]. Activation of TonEBP by hypertonicity is typically accompanied with induction of HSP70. In rats, Hsp70-1 responds to tonicity, as well as heat. Here, we found that HSP70 (Hsp70-1) was induced by hypertonicity (Fig. 3C), indicating that TonEBP is activated in TR-TBT 18d-1 cells in hypertonic medium. HSP70 is abundantly expressed in the renal medulla, where it plays a cytoprotective role against high concentrations of cellular urea [6]. Ito et al. reported TonEBP-mediated upregulation of TauT [24]. Taken together, these results suggest that TauT is induced via a TonEBP-mediated pathway in TR-TBT 18d-1 cells. Additional studies are needed to clarify whether BGT-1 and ATA2 are also induced. On the other hand, TonEBP-mediated downregulation of OCTN2 by hypertonicity has recently been suggested by Cotton et al. [44]. The decreased expression of OCTN2 observed in the present study is consistent with their finding. The multiple functions of TonEBP and the mechanism of downregulation of ENT1 and CNT1 remain for future investigation.

In conclusion, TR-TBT 18d-1 cells exhibit hypertonicity-inducible functional expression of TauT and system A. Our results suggest that osmolyte transporter-mediated cytoprotection against osmotic stress contributes to the maintenance of syncytiotrophoblast function.

Back to Article Outline

Acknowledgements 

This study was supported in part by a Grant-in-Aid for Scientific Research from the Ministry of Education, Culture, Sports, Science and Technology (MEXT), Japan, a grant from the “High-Tech Research Center” Project for Private Universities: matching fund subsidy from MEXT 2004-2008, the Science Research Promotion Fund from the Promotion and Mutual Aid Corporation for Private Schools of Japan, a grant from The Nagai Foundation, Tokyo, and a grant from the Joint Research Project under the Japan-Korea Basic Scientific Cooperation Program of the Japan Society for the Promotion of Science (JSPS) and the Korea Science & Engineering Foundation (KOSEF).

Back to Article Outline

References 

  1. Ladella SJ, Desai M, Cho Y, Ross MG. Maternal plasma hypertonicity is accentuated in the postterm rat. Am J Obstet Gynecol. 2003;189:1439–1444
  2. Bagnasco S, Balaban R, Fales HM, Yang YM, Burg M. Predominant osmotically active organic solutes in rat and rabbit renal medullas. J Biol Chem. 1986;261:5872–5877
  3. Weik C, Warskulat U, Bode J, Peters-Regehr T, Haussinger D. Compatible organic osmolytes in rat liver sinusoidal endothelial cells. Hepatology. 1998;27:569–575
  4. Miller TJ, Hanson RD, Yancey PH. Developmental changes in organic osmolytes in prenatal and postnatal rat tissues. Comp Biochem Physiol A Mol Integr Physiol. 2000;125:45–56
  5. Shimizu M, Satsu H. Physiological significance of taurine and the taurine transporter in intestinal epithelial cells. Amino Acids. 2000;19:605–614
  6. Woo SK, Lee SD, Kwon HM. TonEBP transcriptional activator in the cellular response to increased osmolality. Pflugers Arch. 2002;444:579–585
  7. Akahori S, Ejiri K, Sekiba K. Taurine concentrations in fetal, neonatal and pregnant rats. Acta Med Okayama. 1986;40:93–101
  8. Smith KE, Borden LA, Wang CH, Hartig PR, Branchek TA, Weinshank RL. Cloning and expression of a high affinity taurine transporter from rat brain. Mol Pharmacol. 1992;42:563–569
  9. Tomi M, Tajima A, Tachikawa M, Hosoya K. Function of taurine transporter (Slc6a6/TauT) as a GABA transporting protein and its relevance to GABA transport in rat retinal capillary endothelial cells. Biochim Biophys Acta. 2008;1778:2138–2142
  10. Anderson CM, Howard A, Walters JR, Ganapathy V, Thwaites DT. Taurine uptake across the human intestinal brush-border membrane is via two transporters: H+-coupled PAT1 (SLC36A1) and Na+- and Cl−-dependent TauT (SLC6A6). J Physiol. 2009;587:731–744
  11. Borden LA, Smith KE, Gustafson EL, Branchek TA, Weinshank RL. Cloning and expression of a betaine/GABA transporter from human brain. J Neurochem. 1995;64:977–984
  12. Burnham CE, Buerk B, Schmidt C, Bucuvalas JC. A liver-specific isoform of the betaine/GABA transporter in the rat: cDNA sequence and organ distribution. Biochim Biophys Acta. 1996;1284:4–8
  13. Sugawara M, Nakanishi T, Fei YJ, Huang W, Ganapathy ME, Leibach FH, et al. Cloning of an amino acid transporter with functional characteristics and tissue expression pattern identical to that of system A. J Biol Chem. 2000;275:16473–16477
  14. Sugawara M, Nakanishi T, Fei YJ, Martindale RG, Ganapathy ME, Leibach FH, et al. Structure and function of ATA3, a new subtype of amino acid transport system A, primarily expressed in the liver and skeletal muscle. Biochim Biophys Acta. 2000;1509:7–13
  15. Albers A, Broer A, Wagner CA, Setiawan I, Lang PA, Kranz EU, et al. Na+ transport by the neural glutamine transporter ATA1. Pflugers Arch. 2001;443:92–101
  16. Champion EE, Mann SJ, Glazier JD, Jones CJ, Rawlings JM, Sibley CP, et al. System beta and system A amino acid transporters in the feline endotheliochorial placenta. Am J Physiol Regul Integr Comp Physiol. 2004;287:R1369–R1379
  17. Yamauchi A, Uchida S, Kwon HM, Preston AS, Robey RB, Garcia-Perez A, et al. Cloning of a Na+- and Cl−-dependent betaine transporter that is regulated by hypertonicity. J Biol Chem. 1992;267:649–652
  18. Uchida S, Kwon HM, Yamauchi A, Preston AS, Marumo F, Handler JS. Molecular cloning of the cDNA for an MDCK cell Na+- and Cl−-dependent taurine transporter that is regulated by hypertonicity. Proc Natl Acad Sci U S A. 1992;89:8230–8234
  19. Petronini PG, Alfieri RR, Losio MN, Caccamo AE, Cavazzoni A, Bonelli MA, et al. Induction of BGT-1 and amino acid system A transport activities in endothelial cells exposed to hyperosmolarity. Am J Physiol Regul Integr Comp Physiol. 2000;279:R1580–R1589
  20. Ko BC, Lam AK, Kapus A, Fan L, Chung SK, Chung SS. Fyn and p38 signaling are both required for maximal hypertonic activation of the osmotic response element-binding protein/tonicity-responsive enhancer-binding protein (OREBP/TonEBP). J Biol Chem. 2002;277:46085–46092
  21. Trama J, Go WY, Ho SN. The osmoprotective function of the NFAT5 transcription factor in T cell development and activation. J Immunol. 2002;169:5477–5488
  22. Woo SK, Lee SD, Na KY, Park WK, Kwon HM. TonEBP/NFAT5 stimulates transcription of HSP70 in response to hypertonicity. Mol Cell Biol. 2002;22:5753–5760
  23. Na KY, Woo SK, Lee SD, Kwon HM. Silencing of TonEBP/NFAT5 transcriptional activator by RNA interference. J Am Soc Nephrol. 2003;14:283–288
  24. Ito T, Fujio Y, Hirata M, Takatani T, Matsuda T, Muraoka S, et al. Expression of taurine transporter is regulated through the TonE (tonicity-responsive element)/TonEBP (TonE-binding protein) pathway and contributes to cytoprotection in HepG2 cells. Biochem J. 2004;382:177–182
  25. Lopez-Rodriguez C, Antos CL, Shelton JM, Richardson JA, Lin F, Novobrantseva TI, et al. Loss of NFAT5 results in renal atrophy and lack of tonicity-responsive gene expression. Proc Natl Acad Sci U S A. 2004;101:2392–2397
  26. Kitano T, Iizasa H, Terasaki T, Asashima T, Matsunaga N, Utoguchi N, et al. Polarized glucose transporters and mRNA expression properties in newly developed rat syncytiotrophoblast cell lines, TR-TBTs. J Cell Physiol. 2002;193:208–218
  27. Chishu T, Sai Y, Nishimura T, Sato K, Kose N, Nakashima E. Potential of various drugs to inhibit nucleoside uptake in rat syncytiotrophoblast cell line, TR-TBT 18d-1. Placenta. 2008;29:461–467
  28. Sato K, Sai Y, Nishimura T, Chishu T, Shimpo S, Kose N, et al. Influx mechanism of 2’,3’-dideoxyinosine and uridine at the blood-placenta barrier. Placenta. 2009;30:263–269
  29. Sai Y, Nishimura T, Shimpo S, Chishu T, Sato K, Kose N, et al. Characterization of the mechanism of zidovudine uptake by rat conditionally immortalized syncytiotrophoblast cell line TR-TBT. Pharm Res. 2008;25:1647–1653
  30. Nishimura T, Seki Y, Sato K, Chishu T, Kose N, Terasaki T, et al. Enhancement of zidovudine uptake by dehydroepiandrosterone sulfate in rat syncytiotrophoblast cell line TR-TBT 18d-1. Drug Metab Dispos. 2008;36:2080–2085
  31. Cetin I, Ronzoni S, Marconi AM, Perugino G, Corbetta C, Battaglia FC, et al. Maternal concentrations and fetal-maternal concentration differences of plasma amino acids in normal and intrauterine growth-restricted pregnancies. Am J Obstet Gynecol. 1996;174:1575–1583
  32. Norberg S, Powell TL, Jansson T. Intrauterine growth restriction is associated with a reduced activity of placental taurine transporters. Pediatr Res. 1998;44:233–238
  33. Roos S, Powell TL, Jansson T. Human placental taurine transporter in uncomplicated and IUGR pregnancies: cellular localization, protein expression, and regulation. Am J Physiol Regul Integr Comp Physiol. 2004;287:R886–R893
  34. El-Sherbeny A, Naggar H, Miyauchi S, Ola MS, Maddox DM, Martin PM, et al. Osmoregulation of taurine transporter function and expression in retinal pigment epithelial, ganglion, and muller cells. Invest Ophthalmol Vis Sci. 2004;45:694–701
  35. Fujita T, Shimada A, Wada M, Miyakawa S, Yamamoto A. Functional expression of taurine transporter and its up-regulation in developing neurons from mouse cerebral cortex. Pharm Res. 2006;23:689–696
  36. Kang YS, Ohtsuki S, Takanaga H, Tomi M, Hosoya K, Terasaki T. Regulation of taurine transport at the blood-brain barrier by tumor necrosis factor-alpha, taurine and hypertonicity. J Neurochem. 2002;83:1188–1195
  37. Tomi M, Terayama T, Isobe T, Egami F, Morito A, Kurachi M, et al. Function and regulation of taurine transport at the inner blood-retinal barrier. Microvasc Res. 2007;73:100–106
  38. Takanaga H, Tokuda N, Ohtsuki S, Hosoya K, Terasaki T. ATA2 is predominantly expressed as system A at the blood-brain barrier and acts as brain-to-blood efflux transport for L-proline. Mol Pharmacol. 2002;61:1289–1296
  39. Peters-Regehr T, Bode JG, Kubitz R, Haussinger D. Organic osmolyte transport in quiescent and activated rat hepatic stellate cells (Ito cells). Hepatology. 1999;29:173–180
  40. Takanaga H, Mackenzie B, Suzuki Y, Hediger MA. Identification of mammalian proline transporter SIT1 (SLC6A20) with characteristics of classical system imino. J Biol Chem. 2005;280:8974–8984
  41. Clow KA, Treberg JR, Brosnan ME, Brosnan JT. Elevated tissue betaine contents in developing rats are due to dietary betaine, not to synthesis. J Nutr. 2008;138:1641–1646
  42. Slow S, Lever M, Chambers ST, George PM. Plasma dependent and independent accumulation of betaine in male and female rat tissues. Physiol Res. 2009;58:403–410
  43. Arroyo JA, Teng C, Battaglia FC, Galan HL. Determination of the NFAT5/TonEBP transcription factor in the human and ovine placenta. Syst Biol Reprod Med. 2009;55:164–170
  44. Cotton LM, Rodriguez CM, Suzuki K, Orgebin-Crist MC, Hinton BT. Organic cation/carnitine transporter, OCTN2, transcriptional activity is regulated by osmotic stress in epididymal cells. Mol Reprod Dev. 2010;77:114–125

PII: S0143-4004(10)00298-5

doi:10.1016/j.placenta.2010.08.003

Placenta
Volume 31, Issue 11 , Pages 1003-1009, November 2010

Article Tools

* Image Usage & Resolution